Реклама часов текст: Копирайтинг для магазинов наручных часов

Содержание

Шедевры рекламы наручных часов

Реклама наручных часов всегда вдохновляла нас, и даже больше — если реклама представляет собой нечто умное, забавное или вызывает особенное чувство внутри, то это скорее подталкивает к покупке. И, разумеется, огромные деньги вкладываются в рекламу элитных часов. На сегодняшний день нет конкретной суммы, которая тратится в мире на рекламу роскоши, однако, как сообщает WatchTime, в 2013-м году 69 часовых брендов потратили на рекламу своей премиум-продукции на рынке одних только Соединенных Штатов Америки более $1,000,000, а во всем мире — $467,410,000. Уверены, к моменту написания этой статьи сумма если не удвоилась, то определенно значительно возросла.

Все рекламные кампании со всеми вложенными в них инвестициями направлены на то, чтобы вызвать у потребителя то самое «я хочу» чувство, для чего маркетологи брендов находятся в постоянном поиске вдохновения и креативной идеи.

Ниже мы представляем подборку самых креативных на наш взгляд рекламных кампаний часовых брендов:


IWC превратили обычный автобусный ремень в нечто напоминающее Big Pilot.


Будет трудно найти кого-то, кто бы оспорил, что «You never actually own a Patek Philippe, you merely look after it for the next generation» от Patek Philippe — одна из самых успешных рекламных кампаний в часовой индустрии. Разумеется, кто не хочет Patek Philippe? Тем не менее, глядя на свою mini-me версию, бегающую по дому, Вы скажете себе (или своей жене): «Я не просто трачу 37,000 долларов на себя. Это реликвия!»

Omega — это рекламный джаггернаут, безжалостное средство. Вы только взгляните на это остроумное винтажное рекламное объявление: (пер. «Как может человек в костюме за $27,000 высадиться на Луну в часах за $235?»)


Hublot в свое время представили хоть и спорную, но тем не менее действующую рекламу, нанеся на объявление изображение избитого Bernie Ecclestone, CEO бренда на тот момент, и слоган «Видите, что люди готовы сделать за Hublot?»



Breguet имеет одни из самых глубоких корней в часовом деле, и поэтому со стороны бренда было очень мудро использовать их в своей рекламе. Бренд обратил внимание на известных мировых личностей, таких, как Наполеон Бонапарт, Мари Антонетте, и сэр Винстон Черчилль.

И снова, IWC напоминают о себе пускай несколько дерзкой, но создавшей огромный фурор рекламой. (пер. «Почти такие же сложные, как женщина. За исключением того, что всегда вовремя».



Наручные часы: новое мужское достоинство — Секреты стиля



Текст: Виктория ШОРОХОВА
Источник: Мужской журнал

Настоящего мужчину видно по часам. Это словно кодовый знак, символ
принадлежности к определенному сообществу. Это вещь, по взгляду на
которую единомышленник распознает единомышленника, противник —
противника, партнер — партнера. Часы говорят о многом: о вкусах, об
аккуратности, точности, благосостоянии, положении. Мужские часы — это
вещь, которая передается по наследству. А если уж передавать их
наследнику, то это должен быть предмет такого качества, которое выдержит
время.

Неотъемлемый аксессуар

Часы для мужчины — предмет гордости.

Сегодня мужские наручные часы утратили свою значимость, как
основной ориентир во времени, теперь это незаменимый аксессуар успешных
людей. Можно не носить перстни, запонки
и даже не надевать обручальное кольцо, но часы — это символ надежности,
мужественности, уверенности. Еще в советское время далеко не многие
мужчины могли позволить себе сей аксессуар. Обладателями были только
состоятельные и успешные. Такие мужчины всегда знали время, отвечали за
свои слова и не опаздывали ни на минуту. Эти же качества ценятся в
деловом человеке и сегодня, поэтому часы на руке играют такую
значительную роль. Правильно оценив часы, они могут многое рассказать о
характере и стиле жизни владельца, а также будут удачным завершением
любого имиджа.

Классические часы

Строгость и элегантность остается актуальными всегда, несмотря на веяния моды и смену сезонов.

Часы классического вида,
как правило, не отягощены излишними функциями, они показывают только
время и дату. Их неизменным атрибутом является кожаный ремешок черного
или коричневого цвета. Чаще всего классический вариант часов имеет
круглую форму, реже — квадратную, прямоугольную или бочкообразную.
Циферблат обычно выполнен в белом или черном цвете. Ничего лишнего.
Классические наручные часы имеют водозащиту WR 30, за счет чего они
сохраняют стандартный размер и элегантно сморятся на запястье.

Спортивные часы


Спортивные часы удобны в использовании.

Такие часы идеально подходят для людей, поддерживающих активный образ
жизни и увлекающихся спортом. Они незаменимы для яхтсменов и туристов.
Часы имеют дополнительную защиту корпуса и водозащиту. Как правило, спортивные модели часов довольно массивны, поэтому они вполне способны подчеркнуть мужественность своего владельца. Форма спортивных часов, чаще всего округлая. Браслет может быть либо стальным, либо каучуковым. В редких случаях ремешок бывает кожаным, но тогда он обязательно обрабатывается водоотталкивающей пропиткой. Цифры и метки, расположенные на циферблате, имеют более крупный, чем у других моделей, размер, что позволяет без труда разглядеть их показания в любой момент. Помимо времени и даты хорошие спортивные часы обладают рядом
дополнительных функций: они могут иметь хронограф, хронометр и тахиметр.
Вы никогда не увидите золото на спортивных часах, потому что этот
материал имеет большой удельный вес и часы получаются довольно тяжелыми.

Часы в стиле casual

Для деловых будней, романтических вечеров, отдыха и прогулок не важно
в каком вы стиле одеты, подходят повседневные часы — надежные, удобные,
функциональные, универсальные. Модели этого вида, в отличие от
классических часов, более устойчивы к внешним повреждениям и лучше
защищены от влаги, однако при этом они не выглядят массивными.
Повседневные наручные часы могут быть как на стальном браслете, так и на
кожаном ремне. По форме такие часы могут быть разнообразными: круглыми,
квадратными, прямоугольными. Циферблат, как правило, выполнен в
классическом стиле. Часы в стиле casual не выделяются обилием украшений — только четко выверенный стиль.

Представительские часы

Представительские часы — визитная карточка мужчины.

Этот тип часов идеально подойдет для официальных мероприятий, где очень
важно произвести впечатление на публику. Обычно такие часы имеют самые
разнообразные формы и максимальное количество функций: турбийон,
репетир, вечный календарь, фаза луны и другие. Представительские часы непременно должны быть швейцарских марок и по-настоящему дорогими.

Выбор наручных часов

Ноу-хау — часы с вулканической пылью.

Вулкан с непроизносимым названием Eyjafjallajokull,
расположенный в Исландии, не только подпортил жизнь Европе, но и попал
прямо в часы. Швейцарская компания Romain Jerome сообщила, что
разработала модель наручных часов Eyjafjallajokull-DNA, в которой будут
присутствовать частицы горной породы, собранные у вулкана, а также
частицы вулканической пыли. Правда часы будут выпущены в строго
ограниченном количестве — буквально в одном экземпляре. А чтобы не было
сомнений в подлинности вулканических материалов, компания Romain Jerome
предоставит обладателю соответствующий сертификат, заверенный подписями и
печатями экспертов.

Наручные часы без труда можно подобрать к любому стилю одежды. Однако стоит помнить, что цветовая гамма кожаного ремешка часов должна обязательно совпадать с цветом ботинок и брючного ремня.
При этом очень важно уметь соблюсти баланс стоимости одежды и
аксессуаров. Дорогие часы не будут сочетаться с дешевыми ботинками, это
может вызвать ощущение, что на руке подделка и наоборот — дешевое
произведение нельзя надевать с дорогим брендовым костюмом. Важно
понимать, на какой случай жизни вы приобретаете наручные часы. Ведь
представительские часы не предназначены для прогулок по горам или
активных тренировок в спортзале и излишне роскошны для повседневной
работы в офисе. Именно поэтому стилисты рекомендуют иметь как минимум
две модели наручных часов, одна из которых обязательно должна быть
классической или повседневной.

При выборе наручных часов важно обратить внимание на внешний вид. Часы
должны быть сделаны аккуратно: метки и цифры на циферблате должны быть
четкими, стрелки элегантными и тонкими, надписи изящными. Корпус часов
должен совпадать с кистью обладателя. Не стоит брать модель, если ушки
циферблата вылезают за кисть, потому что ваша рука в таких часах будет
казаться слишком тонкой. Но и крохотный корпус на мощной руке смотреться
не будет. Тонкая кисть выглядит изящно и элегантно в небольших
аккуратных часах, тогда как массивная модель придаст мужественности
широкой кисти. Если ремешок ваших часов выполнен в виде стального
браслета, он должен сидеть на кисти руки настолько свободно, чтобы вы
всегда могли повернуть часы вокруг кисти, однако не настолько слабо,
чтобы болтаться на ней. Модель, оснащенная кожаным ремешком, тоже не
должна туго обхватывать кисть. Застегивая ремешок, оставляйте между ним и
кистью небольшое пространство, достаточное для того, чтобы в него
прошел один палец.

10:10

10 часов 10 минут.

Вы когда-нибудь обращали внимание, что на рекламе наручных часов чаще всего время соответствует 10 часам 10 минутам?
Загадочный феномен, который был назван всемирным заговором, впервые был
замечен в 2005 году. Объяснений такому явлению нашли несколько. Первая —
так называемая маркетологическая версия. Согласно ей стрелки на часах
словно символизируют улыбку. Это значит у того, кто смотрит на рекламу
не возникнет неосознаваемого чувства подавленности, в случае если бы стрелки смотрели на 16:40 — изображали бы печаль. Практичная версия говорит о том, что стрелки в любом другом положении на современных хронометрах и часах закрывают логотип, дополнительные циферблаты и украшения. А положение стрелок на 10:10
дает человеку возможность хорошо рассмотреть часы. Согласно «порядочной»
версии, когда минутная стрелка стоит на десяти минутах, часовая стрелка
стоит практически точно на цифре часа. Это придает виду часов
порядок и благородство. А 10 часов вдобавок к 10 минутам выбраны строго
из соображений симметрии. Опять же ради порядка и строгости вида. Еще
одной версией называется «промышленная», согласно которой именно в таком
положении устанавливают стрелки при конвейерной сборке. И для рекламы
снимают абсолютно новые часы, только что сошедшие с конвейера и не
ходившие ни секунды.


Каждый склонен трактовать по своему эту комбинацию цифр.

Также есть ряд версий, не поддающихся логике. Конспирологическая
версия говорит о том, что «10:10» это какое — то зашифрованное
сообщение, которым регулярно обмениваются члены некоего тайного
общества. Что обозначает это сообщение, история умалчивает. Вероятно,
магия чисел тут тоже имеет место быть. Многие люди загадывают желание при одинаковом сочетании цифр на часах.
Писатель Дэн Браун также выдвинул свою версию этих загадочных цифр.
Браун полагает, что положение стрелок 10:10 — сообщение от старейшей
антифашисткой организации всем своим членам. По его мнению стрелки в
положении «10:10» образуют угол ровно 115 градусов. А 115 градусов по
Цельсию — это как раз температура, при которой закипает антифриз.
«Антифриз» созвучно «анти-фриц» — именно такое название носила
организация, партизанившая в годы Второй мировой на территории Восточной
Европы. писатель полагает, что когда руководители «Анти-фрица» решат,
что их миссия полностью выполнена, рекламные объявления изменятся:
стрелки придут в положение «11:05». «11:05» однозначно читается как «V» —
«victory». Смысл сообщения очень прост: победа за нами!

Однако в современной рекламе часов встречается абсолютно произвольное
расположение стрелок, не говоря уже о рекламе начала и середины XX
века. Поэтому вполне вероятно, что ни одна из высказанных версий не
имеет права на существование. Хотя справедливости ради нужно сказать,
что часов с «улыбками» в рекламе куда как больше.

Узнайте больше о рекламе со статусом «на проверке».

Прежде чем показывать вашу рекламу на Facebook или в Instagram, мы проверяем ее на соответствие Правилам рекламной деятельности. Проверка рекламы запускается автоматически перед началом показа, а ее статус можно посмотреть в соответствующем столбце в Ads Manager.

Процесс проверки рекламы

Миллионы объявлений, которые показываются в наших приложениях, проверяются на соответствие Правилам рекламной деятельности с помощью нашей автоматизированной системы проверки. Однако в некоторых случаях мы проверяем рекламу вручную, что также позволяет нам совершенствовать эту систему.

Наша система проверяет объявления на соответствие Правилам рекламной деятельности. Мы проверяем изображения, видео, текст, информацию о таргетинге и другие элементы рекламы, а также содержание места назначения рекламы. Место назначения — это страница или другое место, куда переходит человек после нажатия на объявление.

В результате проверки мы можем одобрить или отклонить вашу рекламу.

Продолжительность проверки рекламы

Большая часть рекламы рассматривается в течение 24 часов, но в некоторых случаях это может занять больше времени. Мы можем повторно проверять рекламу, в том числе опубликованную.

Если вы хотите начать показ своей рекламы с определенной даты в будущем, то можете запланировать ее показ. Как только вы отправите рекламу, мы проверим ее, но не будем начинать показ до указанной вами даты.

Ограничения при проверке

Мы стремимся проверить как можно больше объявлений, однако в этом процессе есть свои сложности. Наши меры по обеспечению соблюдения правил имеют свои недостатки. Как системы, так и люди иногда могут ошибаться.

Когда мы вводим новое правило, системе контроля и нашим специалистам нужно время, чтобы научиться правильно следить за его соблюдением. Однако получая отзывы пользователей и новые данные, наша система на основе машинного обучения становится лучше.

Если вы считаете, что ваше объявление, группу объявлений, кампанию или товар отклонили по ошибке, то можете запросить повторную проверку в разделе Качество аккаунта. Подробнее о том, что делать, если вашу рекламу отклонили.

Если вы считаете, что реклама на Facebook нарушает Правила рекламной деятельности, то можете на нее пожаловаться. Подробнее о том, как пожаловаться на рекламу.

Редактирование запланированного или действующего объявления

Запланированные или действующие объявления либо группы будут отправлены на повторную проверку, если в них были изменены следующие параметры:

  • Таргетинг

  • Креатив (например, изображения, текст, ссылки или видео)

  • Оптимизация

  • Событие биллинга

Если вы измените бюджет, размер ставки или график показа группы объявлений, повторная проверка не начнется.

Статьи по теме

Скрытая реклама в романе «Евгений Онегин»

На страницах романа «Евгений Онегин» Александр Пушкин упоминал «бренды», популярные в России начала XIX века. Вспоминаем фирмы, продукцией и услугами которых пользовались русские аристократы.

Шляпа боливар

Джон Джеймс Чэлон. Модная лавка в Париже. 1822

Надев широкий боливар,
Онегин едет на бульвар.

Черный цилиндр с широкими полями — так выглядел самый модный головной убор той поры. На иллюстрациях к роману персонажей обычно изображают именно в боливарах.

В XIX веке головные уборы нередко называли в честь общественных деятелей, и некоторые люди даже выражали с помощью шляп свои политические взгляды. В 1821–1823 годах, когда поэт приступал к работе над романом, популярность обрели цилиндры, названные в честь генерала Симона Боливара. Он был национальным героем Южной Америки, вождем борьбы за независимость американских колоний от Испании. В тот период генерал как раз освобождал Перу, а в 1825 году стал главой республики Боливия, названной в его честь.

Сторонники Боливара носили широкополые шляпы, которые проникли в европейскую моду в 1810-х годах. Их поля, как упоминал бытописатель Михаил Пыляев, часто оказывались настолько широкими, что невозможно было пройти в узкую дверь. Однако уже в 1825 году модный московский журнал «Московский телеграф» написал о том, что боливары теряют популярность. Так что Онегина автор одел в точности по моде начала 1820-х годов. И кроме того, намекнул на его политические симпатии.

Часы «брегет»

Елена Самокиш-Судковская. Иллюстрация к роману Александра Пушкина «Евгений Онегин». Издание т-ва Р. Голике и А. Вильборг, 1908

И там гуляет на просторе,
Пока недремлющий брегет
Не прозвонит ему обед.

Щеголю Онегину не нужно было вынимать часы из кармана, чтобы взглянуть на циферблат, — достаточно было запустить внутрь руку, нажать на пружинку, и часы отзванивали время. Эта особенность часов с репетиром (как тогда говорили, «с репетицией»), в частности тех, что выпускала фирма Breguet, сделала их практически синонимом будильника. Пушкин упоминал их в тексте несколько раз: перед ужином «желудок — верный наш брегет» намекал героям на время трапезы; перед спектаклем «звон брегета им доносит, что новый начался балет».

Основателем фирмы Breguet был часовой мастер Абрахам-Луи Бреге. Швейцарец по рождению, свой первый магазин он открыл в 1775 году в Париже. Брегеты славились не только точностью, но и тем, что среди них не попадались одинаковые модели. Покупатель мог быть уверен, что точно таких же часов, как у него, больше ни у кого нет. Сейчас марка Breguet — одна из старейших сохранившихся до наших дней.

Русский рынок Бреге начал осваивать в 1801 году, и уже в 1808-м в Санкт-Петербурге открылось представительство модной компании. Среди поклонников марки были князья Голицыны, Гагарины, Юсуповы и даже император Александр I. Брегет «подарил» своему персонажу и Александр Пушкин.

Читайте также:

Любопытно, что покупатели продукции Бреге — образованные аристократы — конечно, знали верное произношение французской фамилии. Однако в русский язык название фирмы вошло в буквальном прочтении — с буквой «т» на конце. К тому же так было удобнее рифмовать.

Ресторан Талона

Дмитрий Белюкин. Иллюстрация к роману Александра Пушкина «Евгений Онегин». Издательство «Андреевский флаг», 2002

К Talon помчался: он уверен,
Что там уж ждет его Каверин.

Пушкин не просто отправляет своего героя обедать у Талона — он вдобавок ставит к его фамилии специальную сноску с текстом «известный ресторатор», чтобы читатель обязательно обратил внимание на эту фамилию. Быть может, Талон предоставил за это поэту скидку?

Ведь Пушкин мог отправить Онегина, например, в заведение господина Андрие на Малой Морской, 15, где, по свидетельству Фаддея Булгарина, «обедывали» чиновники и министры. В этом ресторане неоднократно бывал и сам Пушкин, и именно там он познакомился с Жоржем Дантесом.

Однако поэт выбрал для Онегина модный ресторан Пьера Талона на Невском проспекте. Ресторан занимал дом Косиковского у Полицейского моста. Здесь, по словам того же Булгарина, можно было «в полной мере удовлетворить ваши гастрономические потребности». И действительно, Пушкин приводит целый список популярных блюд этого ресторана — roast-beef, трюфели, Страсбургский пирог с паштетом.

В начале 1825 года Талон дал объявление в газетах, что возвращается во Францию. Правда, сразу же после его отъезда в помещении открылся очередной французский ресторан — Фелье. Пушкин наведывался и туда.

Пистолет «Лепаж»

Илья Репин. Дуэль Онегина и Ленского. Иллюстрация к роману Александра Пушкина «Евгений Онегин». 1899. Всероссийский музей А.С. Пушкина

Примчались. Он слуге велит
Лепажа стволы роковые
Нести за ним…

И вот опять Пушкин ставит отдельное примечание к марке «Лепаж», которое гласит — «Славный ружейный мастер». Мастером Лепаж был действительно «славным». Ружейная фирма Le Page (впоследствии — Fauré Le Page) была основана в Париже еще в 1717 году и оставалась в руках одной семьи почти 200 лет — до 1913 года. Основателя фирмы звали Луи Пиньи, но он завещал дело мужу своей племянницы Пьеру Лепажу, и именно под этой фамилией марка прославилась на всю Европу. У фирмы было множество клиентов, в том числе и из самых высших слоев общества — они поставляли оружие и французскому королю Людовику XV, и знаменитому полководцу Морицу Саксонскому.

Пушкин говорит уже о своем современнике Жане Лепаже (племяннике Пьера). У него заказывали оружие несколько правителей Франции: Людовик XVI, Наполеон (сначала консул, затем император), Людовик XVIII. Даже во времена Великой французской революции без Лепажа не обошлось — во время взятия Бастилии и Июльской революции 1830 года его оружие раздавали народу.

И Ленский «выбрал» для дуэли пистолеты фирмы, которая выпускала качественное и роскошное оружие. Такие же были и у самого Александра Пушкина. Считается, что пару пистолетов изготовили для Пушкина по его заказу незадолго до дуэли с Дантесом.

Автор: Софья Багдасарова

7.1. Размещение текста на носителе

7.1. Размещение текста на носителе

Свою оду рекламной «шапке» великий американский маркетолог Огилви начинает с утверждения, что заголовок – это наиболее важный элемент текста рекламного объявления, украшение рекламоносителя. Читатель судит по виду и содержанию заголовка, стоит ли читать все объявление. В среднем заголовок читают в пять раз больше людей, чем текст.[164] Возможно, что рекламист ошибся в расчетах, поскольку другие исследования показали, что уделяют внимание только заголовкам 80 % читателей.[165] Но, как видно, ошибка просто ничтожна. Информация, помещенная в заголовке, – это именно тот инструмент, который сумеет за 4 секунды привлечь внимание человека и заставить его пробежать глазами по остальному тексту.

Заголовок требуется правильно составить и правильно разместить, чтобы он исправно выполнял возложенные на него обязанности. В оптимуме заголовки следует подбирать в 2–3 слова, но это не обязательно. Стоящий заголовок может достигать длины 7–8 слов, а иногда оправдана и длина 10–15 слов (но это предел). Следует стремиться к максимальной понятности «шапки», отсутствию в ней намеков и загадок, туманных образов. Целесообразно упомянуть в «шапке» о некоторых наиболее важных для потребителя свойствах товара и о связанных с этим выгодах (или хотя бы о чем-то одном).

Желательно называть в «шапке» импортные или, что еще лучше, отечественные бренды. Хорошо, когда в заголовке присутствуют слова: бесплатно, бум, гарантия, дешево, новинка, новости, новый, супер, но злоупотреблять ими опасно. Противопоказано употреблять заимствованные восклицания (gee, hey, oh, wow), которые можно использовать вне заголовка (на полях), при этом и то – только в рекламе для лиц моложе 20 лет.

Целесообразно построить фразу, вынесенную в заголовок, таким образом, чтобы она указывала читателю на решение его проблем посредством покупки такого-то товара и т. д. Вместе с тем стоит использовать императив (в вежливой форме), если только длина заголовка не достигает пяти слов. Если заголовок весьма интригующ, но краток, допустимо поместить под ним несколько меньший по размеру подзаголовок, где главная мысль текста объясняется подробнее.

Рис. 5. Эффекты взаимного размещения текста и логотипа.

Заголовок и подзаголовок удобно пространственно комбинировать на листе бумаги с логотипом компании. В зависимости от своей конфигурации комбинация обладает тем или иным психологическим эффектом (см. рис. 5). Если слова пущены вправо или влево от логотипа и напоминают трек, то комбинация символизирует динамику. Когда слова размещены под логотипом в виде пирамидки основанием вверх – это официоз; та же пирамидка основанием вниз дает торжественность, помпу. Если текст отдаленно напоминает по конфигурации песочные часы, в центре которых разместился логотип, то такая комбинация означает оригинальность.

ЗАДАНИЕ № 39. Опытные рекламисты рекомендуют не повторяться впустую, но тем не менее повторять некую удачную конструкцию (слово-находку), чтобы путем итерации усилить воздействие на человека. Найдите такое слово для рекламы зонтов.

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

Лучшие примеры креативной рекламы | Блог YAGLA

Выбирайте работу по душе

 

Так выглядит реклама сайта вакансий в Южной Африке.

 

Этот креатив сочетает в себе немного ужасного и гениального. Замысел – побудить людей отказаться от нелюбимой работы. Иначе они обрастут плесенью и паутиной. Мотивирует? Не то слово!

Сказочки на ночь от Duracell

 

Немного страшилок для детей от производителя «долгоиграющих» батареек Duracell. А что, если и вправду некоторые игрушки никогда не умирают… Добрых вам снов!

Реклама средств для бритья

 

Производители средств для бритья Schick сделали ставку на запоминаемость бренда – и у них это отлично получилось. На такую картинку захочется глянуть второй раз.

Цветы как сюрприз на день Святого Валентина

 

Реклама цветов Interflora привлекает внимание необычной композицией фото. Из текста становится понятно, что делают цветы в мусорке: «Наша задача – уделить внимание каждой детали букета, ваша задача – очистить историю браузера». В смысле, чтобы вторая половинка раньше времени не увидела, что вы искали, где купить цветы.

Пиво Heineken и огромная рука

 

Бутылкой пива огромного размера в рекламе уже никого не удивить. Здесь фишка – рука, которая тянется за этой бутылкой. Точнее, её пугающий силуэт, напоминающий руку зомби. В темное время суток такое наверняка выглядит жутковато.

 

Страх – одно из сильнейших чувств, которое движет людьми. Поэтому его часто используют в рекламе.

Реклама на пляже

 

Наружная реклама, в которой всё продумано и логично. Австралийский онкоцентр предупреждает: отдыхайте от солнца, и при этом само солнце «участвует» в создании креатива.

Спокойная ночь – это тихая ночь

 

Рекламное агентство из Казахстана сделало креатив без применения фотошопа и других сложных графических примочек. Получилась «картинка со звуком». Каждому понятно, о чем речь: слева – бессонная ночь с комарами, справа – тишина и сон, благодаря москитным сеткам, которые тут рекламируются.

Аудиокниги издательства Penguin

 

Этот креатив оценил бы сам Сальвадор Дали!

 

Изобразить «неосязаемое» сложно, а уж рекламировать – тем более. Однако ребята выкрутились, и получилось весьма оригинально. Нарисованные сюрреалистичные наушники заставляют вообразить, будто при прослушивании книг известные авторы собственной персоной шепчут на ухо своим слушателям.

 

Кстати, этому принту достался Золотой Лев на Международном фестивале в Каннах.

Портрет человека из запчастей Harley-Davidson

 

Еще одна работа из числа победителей фестиваля «Каннские Львы». Масса мельчайших деталей на картинке показывает, с какой кропотливостью создаются мотоциклы Harley-Davidson на заказ.

Настольная игра в слова

Украинские рекламщики показали принцип креативной игры Scrabble с помощью не менее креативной рекламы и… тоже выиграли Золотого Льва в Каннах!

 

 

(Pen – ручка, penguin – пингвин)

 

 

(Cat – кошка, caterpillar – гусеница)

 

 

(Car – машина, carrot – морковь)

Система навигации Honda

 

Реклама от дистрибьютора Honda в Кувейте. Посыл рекламы следующий: чтобы добраться до определенного места, не нужно спрашивать дорогу у людей. Их советы скорее путают, чем помогают. У автомобилей Honda есть встроенная система навигации, и это лучшая альтернатива.

Музей архитектуры

 

Эта реклама просто эстетически прекрасна. Авторы показывают, насколько потрясающе смотрелись бы знаменитые российские достопримечательности под водой.

Полезная реклама от IBM

 

Пример, когда наружная реклама не только удивляет, но и приносит практическую пользу. Фирменный билборд-рампа от компьютерной компании IBM.

 

Слоган переводится как «Умные идеи для умных городов».

Интерьерные идеи от IKEA на автобусной остановке

 

Устраивайтесь поудобнее и ждите ваш автобус. Уют должен быть повсюду!

 

Эта реклама рассчитана на то, что человек в ожидании автобуса присядет на диван в эту импровизированную симпатичную комнату, и у него возникнет желание обустроить свое жилище так же, купить те же предметы интерьера. И он будет знать, в какой магазин за ними идти.

Скамейка в виде плитки KitKat

 

Креативщики заметили, что доски, из которых делают скамейки, напоминают структуру шоколадки. В итоге улицу украсил такой яркий предмет экстерьера.

Горячий кофе для города, который никогда не спит

 

Речь о Нью-Йорке. Парящий люк легко может превратиться в чашку кофе, очень похожую на настоящую. С виду и не скажешь, что это фото, напечатанное на виниле.

Примерочная часов в автобусе

 

Некоторые компании умудряются вовлечь человека во взаимодействие с продуктом в повседневной жизни, когда он сам того не подозревает.

 

Так вот невзначай производители часов International Watch Company предлагают пассажирам посмотреть, как стильно выглядят их часы на руке.

Реклама фитнеса в метро

 

Снова реклама в общественном транспорте (на этот раз фитнес-компания) и снова тот же подход для вовлечения. Пассажиры могут «примерить» штангу для себя и вспомнить, что хотели начать заниматься фитнесом. И, возможно, именно это подтолкнет их к тому, чтобы реализовать задуманное.

 

Главное, чтобы никто не попытался подтягиваться на этой штанге – это инсталляция, а потому может сломаться.

Цветущий чай

 

Живые растения помогают рекламировать чай. Первая мысль, которая возникает, глядя на эту композицию: этот чай натуральный. Позитивные ассоциации + украшает уличный экстерьер.

Мощный электроинструмент

 

Гениальная задумка от российских маркетологов. Как еще показать, что дрель с легкостью просверлит стену? На примере настоящей стены!

Чистые стекла без лишних слов

 

Эта реклама позволяет своими глазами увидеть действие стеклоочистителя. Никаких слоганов и прочей болтовни, только результат!

Четкая картинка, как в реальности

 

В рекламе фотоаппаратов похожая концепция – визуализация результата. Билборд показывает картинку природы в 12-кратном зуме, чтобы итоге люди сами оценили качество снимка, а не верили на слово.

Реклама автосигнализации

 

Вот так можно изобразить угон автомобиля, чтобы все поняли, о чем речь. Плюс здесь фишка в заголовке – краткий и попадает в боль аудитории.

Автомобиль, который «рвет пространство»

 

Позиционирование и исполнение на пять с плюсом. Такую наружную рекламу невозможно не заметить на дороге.

Реклама, которая стала достопримечательностью

 

На башне «Федерация» в Москве (а это самое высокое здание в Европе) изображен огромный гаджет. Этот термометр показывает температуру воздуха и попутно продвигает новинки модельного ряда британских MINI.

 

Замысел креатива – показать, что эти авто подходят для любой погоды, от +40° до −40°С.

 

И еще один пример из тематики авто…

Smart-автомобили

 

Для крошечных авто – крошечная реклама:) Такая милота обязательно обратит на себя внимание.

Сковородки, которые не ломаются

 

Кстати, вы знали, что столб от рекламного билборда можно использовать как… ручку для сковородки?! Смысл в том, чтобы показать, что ручки этих сковородок выдерживают самые сильные нагрузки.

Посылки от FedEx

 

Креатив от американской логистической компании подчеркивает, во-первых, скорость доставки посылок от FedEx с одного континента на другой (обратите внимание на контуры Северной и Южной Америки на здании). Во-вторых, надежность – такую же, как если бы посылка передавалась лично в руки отправителя.

Яндекс.Диск

 

Идея принта построена на игре слов. Понятно и с юмором.

Тайский бокс

 

Здесь всё построено на игре смыслов слов «отвечать» и «пропущенный». Что именно рекламируется – понятно по картинке.

ДО / ПОСЛЕ

 

Этот принт наглядно показывает, на что способны профессионалы-креативщики. Первый вариант – так получится, если сделать своими руками или в другом рекламном агентстве, второй – в агентстве Looma, которое здесь рекламируется. Утрировано, но понятно.

 

Еще больше крутых рекламных принтов смотрите в нашей подборке.

 

Вдохновляйтесь на здоровье!

Опубликовано редакцией Yagla

Функции — Opera Help

Блокировка рекламы

Блокировка рекламы ускоряет загрузку страниц и делает их чище. Блокируя рекламу, вы также блокируете множество отслеживающих файлов cookie. Блокировка рекламы также останавливает сценарии майнинга криптовалюты.

Чтобы начать блокировать рекламу:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Первой функцией будет Block ads (Блокировка рекламы) установите флажок Block ads and surf the web up to three times faster (Блокировать рекламу и работать в интернете в три раза быстрее)
    .

Чтобы включить блокировщик рекламы, вы также можете перейти в меню Easy Setup (Простая настройка) в верхнем правом углу экрана на панели инструментов.

Нажмите кнопку Exceptions (Управление исключениями), чтобы установить настройки для конкретных сайтов. По умолчанию блокировка не будет касаться некоторых сайтов.

При включенной блокировке рекламы в объединенной адресной строке и строке поиска будет отображаться значок. Нажмите на значок, чтобы увидеть дополнительные функции, включая количество заблокированных баннеров, тест скорости и переключатель, снимающий блокировку с отдельных сайтов.

Чтобы предотвратить майнинг криптовалюты, или криптоджекинг, на вашем компьютере установите флажок NoCoin (Cryptocurrency Mining Protection) (NoCoin (защита от майнинга криптовалюты)). Узнать больше о майнинге криптовалюты и мерах, которые мы предпринимаем для его предотвращения.

VPN

В обычном режиме браузер соединяется с сайтами напрямую, позволяя им определять ваш IP-адрес и приблизительное местоположение. Включив VPN, вы соединяетесь с веб-сайтом через VPN-сервер. В результате ваше определяемое местоположение меняется на местоположение сервера.

Для включения VPN выполните следующие действия:

  1. Перейдите в Settings (Настройки)
    (Preferences (Настройки) на Mac).
  2. Нажмите Privacy & security (Конфиденциальность и безопасность) на боковой панели.
  3. Слева от строки VPN установите флажок Enable VPN (Включить VPN).

Это автоматически активирует VPN, и в комбинированной адресной строке и строке поиска появится синий значок VPN. Нажатие на значок отображает переключатель, данные о количестве переданных данных, виртуальном местоположении и виртуальном IP-адресе.

VPN – бесплатная услуга, и объем передаваемых данных не ограничен. Подробнее о том, как VPN защищает вашу безопасность, можно прочитать здесь.

Подробнее о VPN можно прочитать в блоге Opera.

Имейте в виду, что эта функция влияет только на просмотр в браузере Opera. Помните, что остальная часть вашего программного обеспечения, как и другие браузеры или приложения для обмена файлами P2P, не защищены через VPN Opera.

Конвертер валют

При выделении текста, содержащего денежные суммы, например $3010.50zł, ¥800 или 2.00 BTC, появляется всплывающее окно, в котором денежная единица будет конвертирована в нужную вам валюту.

Для правильной работы конвертера валют необходимо выделить соответствующий символ валюты с числовым значением.

Вы можете копировать преобразованное значение в буфер обмена, для этого наведите на него курсор и нажмите появившуюся кнопку Copy (Копировать).

Для определения вашей валюты конвертер использует данные о местоположении в момент установки Opera, однако вы можете отключить эту функцию или изменить свою валюту на странице настроек.

Чтобы изменить настройку валюты по умолчанию для конвертации всех выделенных валют:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Нажмите Features (Возможности) на боковой панели.
  3. В разделе Search pop-up (Всплывающее окно поиска) выберите валюту из выпадающего меню напротив настройки On text selection convert currency to (При выделении текста конвертировать валюту в).

Чтобы отключить конвертер валют для всплывающего окна поиска снимите флажок с On text selection convert currency to (При выделении текста конвертировать валюту в) в Настройках в разделе Всплывающее окно поиска

Ниже приведен перечень валют, которые доступны для конвертации в Opera:

  1. AUD, $ – австралийский доллар
  2. BGN, лв – болгарский лев
  3. BRL, R$ – бразильский риал
  4. BYN – белорусский рубль
  5. CAD, $ – канадский доллар
  6. CHF – швейцарский франк
  7. CNY, ¥ – китайский юань
  8. CZK, Kč – чешская крона
  9. DKK, kr – датская крона
  10. EGP, E£ – египетский фунт
  11. EUR, € – евро
  12. GBP, £ – британский фунт стерлингов
  13. GEL, ლ, ₾ – грузинский лари
  14. HKD, $ – гонконгский доллар
  15. HRK, kn – хорватская куна
  16. HUF – венгерский форинт
  17. IDR, Rp – индонезийская рупия
  18. ILS, ₪ – израильский новый шекель
  19. INR – индийская рупия
  20. JPY, ¥ – японская иена
  21. KZT, ₸ – казахстанский тенге
  22. KRW, ₩ – южнокорейская вона
  23. MXN, $ – мексиканский песо
  24. MYR, RM – малайзийский ринггит
  25. NOK, kr – норвежская крона
  26. NZD, $ – новозеландский доллар
  27. PHP, ₱ – филиппинский песо
  28. PLN, zł – польский злотый
  29. RON, lei – румынский лев
  30. RUB, ₽ – российский рубль
  31. SEK, kr – шведская крона
  32. SGD, $ – сингапурский доллар
  33. THB, ฿ – таиландский бат
  34. TRY – турецкая лира
  35. USD, $ – доллар США
  36. UAH, ₴ – украинская гривна
  37. ZAR, R – южноафриканский рэнд

Обратите внимание, что валюты, обозначаемые общими значками $, kr, ¥ и £, по умолчанию конвертируются в доллары США, норвежские кроны, японские иены и британские фунты стерлингов соответственно.

Конвертер валют обеспечивает возможность конвертации следующих четырех криптовалют:

  1. BTC – биткойн
  2. BTH – биткойн-кэш
  3. ETH – эфириум
  4. LTC – лайткойн

Конвертация валюты производится на основе двух значений справочного курса по данным Европейского центрального банка (ЕЦБ) с использованием ЕВРО в качестве базисной валюты или Национального банка Украины (НБУ) с использованием гривны в качестве базисной валюты.

В качестве настройки по умолчанию в конвертере валют используется курс ЕЦБ. Согласно ЕЦБ справочный курс обновляется по рабочим дням и не обновляется в дни закрытия TARGET (как правило, по субботам, воскресеньям и в определенные праздничные дни). Справочный курс ЕЦБ рассчитывается на основе регулярной ежедневной координационной процедуры между центральными банками по всей Европе. Подробнее о политике и обменных курсах ЕЦБ можно узнать здесь.

Справочные курсы по данным НБУ обновляются двумя группами ежедневно и ежемесячно в соответствии с обменными курсами украинской гривны по отношению к иностранным валютам. Подробнее можно прочитать здесь.

Opera не проводит проверку курсов, поэтому вам следует подтвердить текущий обменный курс в своей финансовой организации, прежде чем выполнять какие-либо финансовые операции.

Конвертер единиц

Как и при конвертации валют, во всплывающем окне возможна конвертация британских и метрических единиц измерения, например, футы ⇄ метры, галлоны ⇄ литры, фунты ⇄ граммы и т.п. Также в конвертер включены градусы Цельсия и Фаренгейта. При выделении значения с британской или метрической единицей измерения во всплывающем окне поиска отображается соответствующее конвертированное значение.

Для правильной работы конвертера единиц необходимо выделить соответствующий символ единицы измерения с числовым значением.

Вы можете копировать преобразованное значение в буфер обмена, для этого наведите на него курсор и нажмите появившуюся кнопку Copy (Копировать).

Ниже приведен перечень единиц измерения, которые доступны для конвертации в Opera:

  1. фунт ⇄ кг
  2. °F ⇄ °C
  3. унция ⇄ г
  4. ми/ч ⇄ км/ч
  5. ми/гал ⇄ л/100 км
  6. гал ⇄ л
  7. кварта ⇄ л
  8. жидк. унция ⇄ мл
  9. ми ⇄ км
  10. ярд ⇄ м
  11. фут ⇄ м
  12. дюйм ⇄ см
  13. дюйм ⇄ мм
  14. кВт ⇄ л.с.
  15. фут-фунт-сила ⇄ Н-м

Конвертер часовых поясов

Если вы живете в Лондоне и столкнулись с неизвестным временем, таким как 18:30 KST, во всплывающем окне поиска время другого часового пояса преобразуется в местное.

Для правильной работы конвертера часовых поясов необходимо выделить сокращение часового пояса со значениями часов и минут (см. форматы ниже). В дополнение к времени и сокращению часового пояса вы также можете выделить дату 17-10-2017, и конвертер преобразует ее в привычный для вас формат.

Вы можете копировать преобразованное значение в буфер обмена, для этого наведите на него курсор и нажмите появившуюся кнопку Copy (Копировать).

Для определения вашего местного часового пояса конвертер использует данные о местоположении вашей системы в момент установки Opera.

Ниже приведен перечень часовых поясов, которые доступны для конвертации в Opera:

  1. PST / PDT: Тихоокеанское поясное / летнее время
  2. MST / MDT: Горное поясное / летнее время
  3. CST / CDT: Центральное поясное / летнее время
  4. EST / EDT: Восточное поясное / летнее время
  5. AST / ADT: Атлантическое поясное / летнее время
  6. NST / NDT: Ньюфаундлендское поясное / летнее время
  7. GMT: Среднее время по Гринвичу
  8. BST: Британское летнее время
  9. MET: Среднеевропейское время
  10. CET / CEST: Центральноевропейское / летнее время
  11. EET / EEST: Восточноевропейское / летнее время
  12. WET / WEST: Западноевропейское / летнее время
  13. JST: Японское стандартное время
  14. KST: Корейское стандартное время
  15. IST: Индийское стандартное время
  16. MSK: Московское стандартное время

Поиск выделенного текста

Всплывающее окно поиска – это небольшая панель инструментов Opera, которая позволяет вам искать или копировать или отправить в Мой Flow, выделенный вами текст на веб-странице. Всего одним нажатием можно запустить поиск выделенного текста в новой вкладке с использованием поисковой системы по умолчанию. Вы также можете копировать текст в буфер обмена, чтобы использовать его позже.

Экономия заряда батареи

Функция экономии заряда батареи позволяет дольше работать в интернете на ноутбуке, не подключенном к электросети, что демонстрирует тест производительности, представленный в этом видео.

Как только кабель питания ноутбука отключается от электросети, рядом с объединенной строкой поиска и адресной строкой появляется значок экономии заряда батареи с советом: Save battery and browse longer! (Экономьте заряд батареи и работайте в интернете дольше!) Если вы воспользуетесь предложением, экономия заряда батареи будет включаться каждый раз, когда кабель питания ноутбука отключается от электросети. Если раньше вы не включали блокировку рекламы, советуем сделать это сейчас: при блокировке рекламы эффективность экономии заряда батареи заметно повышается.

Нажав на значок экономии заряда батареи, вы увидите диалоговое окно с переключателем, ссылку на параметры экономии заряда батареи в меню Settings (Настройки) или Preferences (Настройки) и информацию об оставшемся времени.

Вы можете включить/отключить функцию экономии заряда батареи позже, выбрать время включения функции и включить постоянное отображение значка экономии заряда батареи в меню 

Как работает экономия заряда батареи? Секрет в том, что браузер тратит энергию только на то, что действительно необходимо для работы, за счет снижения активности фоновых вкладок, приостановки плагинов и анимации, переноса времени срабатывания таймеров JavaScript и настройки параметров воспроизведения видео. Однако во время онлайн-игры может потребоваться отключение этой функции.

Подробнее об экономии заряда батареи можно прочитать здесь.

Всплывающие окна с видео

Всплывающие окна с видео позволяют вам просматривать видео, не отвлекаясь от других дел. Перейдите на страницу с видео, такую как Youtube или Vimeo, и запустите его. При наведении курсора на видео в верхней части видеокадра должна появиться кнопка всплывающего окна. Нажмите ее, и видео отделится от страницы и запустится в отдельном регулируемом окне. Тогда вы сможете переключиться на другую вкладку или даже другое приложение, а видео будет отображаться поверх всех окон до тех пор, пока вы его не закроете.

Во всплывающем окне вы можете ставить видео на паузу, регулировать громкость и выбирать следующее видео. Если вы закроете всплывающее видео, его воспроизведение продолжится в исходной вкладке.

Чтобы быстро вернуться к исходной вкладке видео, наведите курсор на заголовок видео во всплывающем окне и нажмите Back to tab (Назад к вкладке).

Вы можете включить/отключить функцию всплывающего окна с видео в меню Settings (Настройки) (Preferences (Настройки) на Mac) > Features (Возможности) > Video pop out (Всплывающее окно с видео).

Закладки

С помощью закладок вы можете сохранять ссылки на страницы. Страницы можно сохранять и добавлять в менеджере закладок для быстрого доступа и систематизации.

Чтобы открыть страницу менеджера закладок, нажмите на значок сердца, расположенный на боковой панели. В качестве альтернативы нажмите Bookmarks (Закладки) на панели меню Mac или в меню O в Windows и Linux.

Добавление закладок

Чтобы добавить текущую страницу в закладки, выполните следующие действия:

  1. Нажмите значок сердца у правого края объединенной адресной строки и строки поиска.
  2. Если вы хотите изменить изображение, связанное с закладкой, нажимайте стрелки влево и вправо с боков эскиза.
  3. Чтобы отнести закладку к какой-либо категории, выберите папку или создайте новую в выпадающем меню.

Все созданные закладки можно найти в менеджере закладок. Чтобы открыть страницу менеджера закладок, нажмите на значок сердца, расположенный на Боковой панели или нажмите Bookmarks (Закладки) на панели меню Mac, или в меню O в Windows и Linux, также можете воспользоваться сочетанием клавиш Ctrl + Shift + B.

Управление закладками

Если навести указатель мыши на закладку, вы увидите различные инструменты управления:

  • Нажмите значок с изображением ручки, чтобы изменить название или местонахождение закладки.
  • Нажмите значок X, чтобы отправить закладку в корзину.

Вы можете менять порядок следования закладок, перетаскивая их по странице. Чтобы поместить закладку в папку, перетащите одну на другую или на существующую папку.

Управление папками закладок

Управление папками закладок

Папки закладок отображаются в текущих папках или на боковой панели менеджера закладок.

Чтобы создать папку закладок:

  1. Перейдите в меню Bookmarks (Закладки).
  2. Нажмите кнопку New Folder + (+ Создать папку) рядом с полем Search bookmarks (Поиск закладок).
  3. Введите название для вашей новой папки.
  4. Нажмите значок с изображением ручки, чтобы создать папку.

Вы можете нажать на новую папку и перетащить ее в любую другую папку либо другое положение на левой боковой панели. Чтобы вложить одну папку в другую, перетащите ее поверх значка второй папки.

Чтобы изменить, удалить или выбрать папку закладок, наведите курсор на папку – вы увидите значки изменения, удаления и выбора.

Вы можете осуществлять выбор и управление несколькими папками, устанавливая флажки на каждой папке. При активном выборе значок становится синим. После этого можно перетащить несколько папок в новое место.

Поиск закладок и применение фильтров

Верхняя панель позволяет найти закладку по названию. По мере того как вы вводите символ за символом названия, Opera фильтрует закладки, просматривая все папки, и помогает вам найти необходимую страницу.

Переключатель в левой части поля поиска позволяет изменять режим отображения закладок. На выбор предлагается два варианта: сетка с изображениями или компактный список.

Управление закладками, отправленными в корзину

Закладки, которые вы удаляете, помещаются в специальную папку – корзину. Если вы случайно отправили закладку или папку закладок в корзину, ничего страшного. Вы легко можете вернуть ее обратно в менеджер закладок.

Чтобы восстановить закладку или папку из корзины, выполните следующие действия:

  1. Выберите папку Trash (Корзина) внизу боковой панели менеджера закладок.
  2. Наведите курсор на закладку или папку, которую вы хотите восстановить.
  3. Нажмите появившуюся кнопку Undo Delete (Отменить удаление).

Закладки восстанавливаются и появляются в папке Unsorted Bookmarks (Несортированные закладки).

Чтобы полностью удалить закладки или папки из корзины, выполните следующие действия:

  1. Выберите папку Trash (Корзина) внизу боковой панели менеджера закладок.
  2. Нажмите кнопку Empty Trash (Очистить корзину), которая находится в верхней правой части страницы.

Использование панели закладок

Панель закладок располагается под объединенной адресной строкой и строкой поиска и обеспечивает быстрый доступ к перечисленным на ней страницам. С ее помощью вы можете перейти на любой из часто посещаемых сайтов, не открывая ни Экспресс-панель, ни менеджер закладок.

Чтобы включить панель закладок на Mac, выберите . В Windows и Linux перейдите в 

Чтобы добавить на панель закладок страницу, в данный момент открытую в браузере, нажмите кнопку +, расположенную у левого края панели (Mac) или нажмите правой кнопкой мыши  (Win/Lin) по панели закладок и выберите Add page (Добавить сайт) . Введите название закладки и нажмите кнопку Save (Сохранить).

Чтобы изменить заголовок закладки на панели, удерживаяCtrl,нажмите левой кнопкой мыши (Mac) или правой кнопкой мыши (Win/Lin) по записи и выберите Edit (Правка).

УдерживаяCtrl,нажмите левой кнопкой мыши (Mac) или правой кнопкой мыши (Win/Lin) на панели закладок, чтобы добавить папку. Чтобы добавить текущую страницу в папку закладок, нажмите название папки и выберите Add Page… (Добавить страницу…). Кроме того, запись можно перетащить в папку с панели закладок.

Синхронизация

Чтобы войти в свою учетную запись Opera, нажмите кнопку учетной записи Opera справа от объединенной адресной строки и строки поиска. Вы также можете сделать это через меню Settings (Настройки) (Preferences (Настройки) на Mac) > Browser (Браузер) > Synchronization (Синхронизация).

Создание и использование учетной записи Opera для наших браузеров помогает синхронизировать все закладки, пароли и историю посещений на других устройствах. После входа на иконке синхронизации появится зеленая галочка. Она показывает, что Opera синхронизирует данные вашего браузера в вашу учетную запись.

Если у вас нет учетной записи Opera, нажмите кнопку Create my Account! (Создать учетную запись), чтобы зарегистрироваться.

Для выхода из сервиса синхронизации нажмите кнопку учетной записи и выберите Sign out (Выйти). После выхода данные, сохраняемые браузером на вашем устройстве, больше не будут объединяться с вашей учетной записью. Например, если вы добавите новую закладку, она не будет синхронизирована на остальные ваши устройства до тех пор, пока вы не войдете обратно в свою учетную запись.

Примечание. При выходе из учетной записи данные не удаляются из браузера. После выхода все данные, синхронизированные в браузер, останутся на вашем устройстве. Аналогичным образом все данные, синхронизированные с вашей учетной записью, сохраняются на серверах Opera.

 

Просмотр синхронизированных данных и управление ими

Opera синхронизирует закладки, вкладки на Экспресс-панелях, историю посещений, пароли, настройки и открытые вкладки. Войдите в свою учетную запись Opera на домашнем и рабочем компьютерах, телефоне и планшете, чтобы содержимое браузера было одинаковым на всех ваших устройствах.

После входа в учетную запись браузер отправляет все сохраненные им данные с вашего устройства в вашу учетную запись Opera. То же самое произойдет при входе в учетную запись на другом компьютере, телефоне или планшете.

Ваши закладки, вкладки на Экспресс-панелях, история посещений, пароли и настройки добавляются в учетную запись Opera и передаются на все устройства, с которых выполняется вход. Подробнее о том, как Opera работает с вашей учетной записью Opera, можно прочитать здесь.

Чтобы выбрать, какие данные нужно синхронизировать в учетной записи Opera:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Нажмите Browser (Браузер) на боковой панели.
  3. В разделе Synchronization (Синхронизация) нажмите кнопку Advanced Configuration (Расширенная настройка).
  4. Установите флажки напротив данных, которые вы хотите синхронизировать.

Просмотр синхронизированных закладок и управление ими

Чтобы просмотреть закладки со своих других устройств, перейдите в Bookmarks (Закладки) > Other bookmarks or Other Speed Dials (Другие закладки или Другие Экспресс-панели) на панели меню Mac или в меню O в Windows и Linux.

Opera объединяет закладки и папки закладок с каждого из устройств. При добавлении новых папок или закладок на различных устройствах боковая панель менеджера закладок обновляется соответствующим образом. Все изменения, внесенные в закладки в менеджере закладок, будут синхронизированы на остальные ваши устройства.  Подробнее о закладках можно прочитать здесь.

Просмотр синхронизированных Экспресс-панелей и управление ими

Для просмотра вкладок на Экспресс-панелях с других устройств и управления ими откройте менеджер закладок, выбрав Bookmarks (Закладки) > Other Speed Dials (Другие Экспресс-панели) на панели меню Mac или в меню O в Windows и Linux.

Opera отображает вкладки на Экспресс-панелях с ваших устройств в виде закладок. Для просмотра, изменения или удаления вкладок на Экспресс-панелях всех ваших устройств нажмите Other Speed Dials (Другие Экспресс-панели) на боковой панели.

Просмотр синхронизированной истории просмотров и управление ею

Чтобы просмотреть полную историю просмотров, выберите Menu – (Меню) History (История) (панель меню Mac; меню O в Windows и Linux). Перейти на страницу History (История) также можно, нажав на значок часов на боковой панели.

Opera собирает историю посещений со всех устройств на эту страницу. Удаляя запись из истории, вы удаляете ее со всех устройств, с которых выполнен вход в учетную запись. Подробнее об удалении личных данных можно прочитать здесь.

Просмотр синхронизированных паролей и управление ими

По умолчанию пароли шифруются с помощью учетных данных Opera. Информация о паролях хранится на серверах Opera и передается на ваши устройства только в зашифрованном виде. С помощью ваших учетных данных Opera дешифрует пароли при входе в учетную запись с других устройств. Когда Opera получает и дешифрует синхронизированные пароли, они сохраняются на вашем компьютере с помощью функции Keychain (Связка ключей).

Если вы желаете шифровать все учетные данные Opera, вы можете назначить главный пароль. При назначении главного пароля будут шифроваться не только ваши пароли, но и все данные синхронизации. Чтобы назначить главный пароль:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Нажмите Browser (Браузер) на боковой панели.
  3. В разделе Synchronization (Синхронизация) нажмите кнопку Advanced Configuration (Расширенная настройка).
  4. В меню Encryption options (Параметры шифрования) выберите Encrypt all synchronized data with your own sync passphrase (Шифровать синхронизируемые данные с использованием вашей собственной парольной фразы синхронизации).
  5. Введите выбранную парольную фразу, подтвердите ее и нажмите OK.

Синхронизированные пароли можно удалить из учетной записи Opera с помощью менеджера паролей Opera. Чтобы управлять паролями по отдельности:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Нажмите Privacy & security (Безопасность) на боковой панели.
  3. В разделе Passwords (Пароли) нажмите кнопку Manage saved passwords (Управление сохраненными паролями).

Примечание. Удаление пароля из менеджера паролей Opera и вашей учетной записи Opera не приводит к удалению данных паролей с локального компьютера. Любые синхронизированные данные паролей остаются на вашем устройстве, и для управления ими необходимо использовать хранилище паролей вашей операционной системы.

 

Просмотр открытых вкладок

Для просмотра открытых вкладок с других устройств нажмите кнопку Tabs (Вкладки) на боковой панели. Подробнее о синхронизированных вкладках можно прочитать здесь.

Интегрированные мессенджеры

Ваши любимые популярные службы обмена сообщениями теперь доступны на боковой панели Opera. Благодаря встроенным службам обмена сообщениями вы всегда сможете общаться в чате с семьей и друзьями на удобной панели, не отвлекаясь от просмотра различных веб-страниц. Вам больше не придется постоянно искать и переключаться на вкладку службы обмена сообщениями при необходимости ответить на сообщение.

Facebook Messenger, WhatsApp, Telegram, и ВКонтакте теперь встроены и доступны в Opera. После входа в соответствующую учетную запись службы обмена сообщениями вы найдете там все ваши контакты и текущие разговоры. Эти службы обмена сообщениями особенно удобны, когда нужно быстро отправить сделанный снимок экрана.

Facebook Messenger и WhatsApp отображаются у правого края боковой панели. Чтобы включить или выключить службы обмена сообщениями на боковой панели, выполните следующие действия:

  1. Перейдите в Settings (Настройки) (Preferences (Настройки) на Mac).
  2. Нажмите Basic (Основные) на боковой панели.
  3. В разделе Sidebar (Боковая панель) нажмите кнопку Manage sidebar… (Управление боковой панелью…).
  4. Выберите необходимые службы обмена сообщениями для боковой панели и нажмите Done (Готово).

Вы также можете добавить или удалить мессенджеры боковой панели через настройки боковой панели:

  1. Щелкните значок с тремя точками внизу боковой панели.
  2. В разделе «Мессенджеры» отметьте мессенджеры, которые вы хотите добавить или удалить.

Здесь вы также можете включить значки уведомлений для служб обмена сообщениями.

Вы также можете, удерживаяCtrl, нажать левой кнопкой мыши (Mac) или правой кнопкой мыши (Win/Lin) на боковой панели начальной страницы, чтобы открыть контекстное меню боковой панели и включить нужные службы обмена сообщениями и другие элементы боковой панели.

Вы сможете войти в систему с использованием учетной записи соответствующей службы обмена сообщениями, нажав по значку службы обмена сообщениями.

Отключение звука, закрепление или выход из системы ваших служб обмена сообщениями

Чтобы открыть службу обмена сообщениями, нажмите по ее значку, а чтобы закрыть – нажмите еще раз.

Открыв одну из служб обмена сообщениями, вы увидите меню из трех точек в левом верхнем углу и значок закрепления в правом углу.

При нажатии на значок закрепления (Кнопка) в правом верхнем углу панели, служба обмена сообщениями будет оставаться открытой при просмотре других веб-страниц. Еще раз нажмите на значок (Кнопка), чтобы открепить службу обмена сообщениями.

Авторизация в службах обмена сообщениями

WhatsApp

  • Нажмите значок WhatsApp на боковой панели. Откроется панель с QR-кодом и инструкциями.
  • Откройте WhatsApp на своем телефоне или планшете, перейдите в настройки и выберите WhatsApp Web.
  • Сканируйте QR-код на панели WhatsApp в Opera.

Facebook Messenger

  • Нажмите значок Facebook Messenger на боковой панели, чтобы открыть панель мессенджера.
  • Введите адрес электронной почты или номер телефона, а также пароль, который вы используете для Messenger.
  • Нажмите Войти.

Telegram

  • Нажмите значок Telegram на боковой панели. Откроется панель и предложит вам войти в аккаунт.
  • Убедитесь, что выбрана правильная страна, введите номер телефона, который вы используете для своей учетной записи Telegram, и нажмите Далее.
  • Вас попросят убедиться, что номер правильный. Если это так, нажмите ОК.
  • Telegram отправит на ваш телефон текст с кодом входа. Введите этот код в панели Telegram в вашем браузере.

ВКонтакте

  • Нажмите на значок ВКонтакте на боковой панели.
  • Если у вас уже есть учетная запись, введите свой адрес электронной почты или номер телефона, а также пароль и нажмите Войти.
  • Если у вас нет учетной записи, нажмите «Зарегистрироваться в ВКонтакте» и следуйте инструкциям или войдите в свою учетную запись с помощью Google или Facebook.

Instagram

  • Нажмите на значок Instagram на боковой панели, чтобы открыть панель Instagram.
  • Введите данные своей учетной записи, чтобы войти в существующую учетную запись, или войти, используя Facebook.
  • Если у вас нет учетной записи, нажмите «Зарегистрироваться».

Twitter

  • Нажмите на значок Twitter на боковой панели, чтобы открыть панель Twitter.
  • Введите свой номер телефона, адрес электронной почты или имя пользователя вместе с паролем и нажмите «Войти».
  • Если у вас нет учетной записи, нажмите «Зарегистрироваться в Twitter».

Отключение звука, закрепление или выход из мессенджера

Каждый мессенджер можно открыть, щелкнув на его значок, а затем закрыть, снова щелкнув на значок.

Когда один из ваших мессенджеров открыт, вы найдете меню в верхнем левом углу и значок булавки в правом углу.

При щелчке по значку откроются функции: отключения звука уведомлений, скрытия панели или выхода из аккаунта.

Если щелкнуть значок булавки в правом верхнем углу панели, мессенджер останется открытым и закрепленным во время просмотра веб-страниц. Нажмите значок еще раз, чтобы открепить мессенджер.

Персонализированные новости

Персонализированные новости помогают вам знакомиться с новыми и модными темами. Это подборка рекомендуемого веб-контента, включающего новости, спорт, искусство и многое другое. Познакомьтесь со списком 50 самых популярных новостей вашего региона.

Чтобы просмотреть страницу новостей, нажмите значок новостей на начальной странице. Если вы нашли интересную новость, нажмите на одну из записей, чтобы перейти к полному тексту статьи в новой вкладке.

Opera группирует ленты новостей в соответствии с вашим местоположением. 50 популярных новостей группируются по рубрикам на основании вашего региона и языка. Для настройки и просмотра другого регионального контента выполните следующие действия.

  1. Перейдите в Personal News (Персонализированные новости)> Top 50 (50 популярных) нажимая на значок газеты на боковой панели.
  2. Создание собственного списка источников: Перейдите в Personal News (Персонализированные новости)> My Sources (Мои источники) нажимая на значок газеты на боковой панели.
  3. Чтобы добавить источник нажмите на Add Sources (Добавить источник).

Создание собственного списка источников

Вы можете выполнить индивидуальную настройку лент новостей для отображения статей из часто посещаемых источников или списка тем, которые представляют для вас интерес. В разделе My Sources (Мои источники) доступен список рекомендуемых или каталогизированных тем. Для добавления собственного источника ленты новостей выполните следующие действия:

  1. Перейдите в
  2. На левой панели выберите My sources (Мои источники).
  3. Чтобы добавить источник, введите его адрес в текстовом поле или выберите из рекомендуемых или популярных источников ниже.

Настройка интервалов обновления для вашей ленты новостей

Вы можете выбрать периодичность обновления ленты новостей Opera с включением нового популярного контента. Вы можете выбрать интервал обновления от пяти минут до шестидесяти минут или установить вариант никогда. Если выбрано никогда, лента новостей будет обновляться только при перезагрузке браузера.

Чтобы изменить интервал обновления вашей персонализированной ленты новостей, выполните следующие действия:

  1. Перейдите в
  2. В разделе Personal news (Персонализированные новости) выберите время в выпадающем меню Check my sources for new content every (Проверять мои источники на наличие нового контента).

Получение уведомлений о доступных источниках ленты новостей

Вы можете получать уведомления, если посещаемый вами веб-сайт имеет RSS-канал, доступный для вашей ленты новостей. В адресной строке появится синий значок новостей.

Чтобы включить уведомления о доступных источниках ленты новостей, установите флажок Show available news feeds on address bar (Отображать доступные ленты новостей в адресной строке) в меню.

Новости на начальной странице

Новости на начальной странице предоставляют самые популярные новостные статьи из Интернета в зависимости от языков и регионов по вашему выбору. Находятся они под закладками Экспресс-панели. Нажмите на выбранную статью, чтобы открыть её в новой вкладке.

Чтобы включить новости на стартовой странице:

  • Перейдите в настройки.
  • Нажмите «Дополнительно» на левой боковой панели и выберите «Возможности».
  • В разделе Начальная страница включите Показывать новости на начальной странице.
    Можно выбрать несколько категорий, чтобы отфильтровать контент, который вы хотите отображать на начальной странице. При просмотре новостей на начальной странице выберите «Все», чтобы получать новости по всем темам, или выберите отдельные темы для персонализированной ленты новостей.

Вы можете выбрать несколько языков и регионов в значке зубчатого колеса в правой части панели категорий.

Снимок

Инструмент для создания снимков экрана Opera представляет собой встроенную в ваш браузер функцию создания снимков экрана, позволяющую делать снимки любой части веб-страницы. Средство создания снимков экрана включает инструменты изменения, позволяющие изменять, выделять и украшать сделанные снимки экранов.

Чтобы сделать снимок экрана, выполните следующие действия:

  1. На веб-странице нажмитеShift + Ctrl +5 ( + +5 на macOS).
  2. Настройте рамку, чтобы обрезать часть веб-страницы перед захватом.
  3. Нажмите Capture (Захват).

Вы можете нажать Capture Full Screen (Захват всего экрана), чтобы сделать снимок всей страницы, на текущий момент отображенной на вашем экране, также известной как область просмотра.

Вы также можете сделать снимок экрана, нажав по значку фотоаппарата на панели инструментов.

Мой Flow

Мой Flow – это зашифрованное пространство, совместно используемое с Opera Touch , Opera for Androidи браузером для вашего компьютера Opera, где вы можете отправлять онлайн-контент, такой, как ссылки, видео YouTube, веб-изображения и личные заметки, чтобы в любое время получать к ним доступ с подключенного телефона или компьютера. Вы также можете быстро и легко обмениваться собственными файлами, такими как изображения и документы, между устройствами. В Мой Flow отображается ваш контент, чтобы помочь вам определить, с какого подключенного устройства что-то было отправлено. Вы можете подключить в Мой Flow несколько устройств. Это отличный способ хранить все организованным и доступным.

Активация Мой Flow

Чтобы использовать My Flow, вам нужен браузер Opera для компьютера и Opera Touch для iOS или Opera Touch для Android. В вашем браузере на рабочем столе:

  • Перейдите в меню Боковой панели и убедитесь, что My Flow включен.
  • Нажмите на значок Мой Flow на боковой панели и откройте QR-кодю
  • Сканируйте код с помощью браузера Opera Touch или Opera Touch для Android.

Чтобы отсканировать код с помощью Opera Touch для iOS:

  • Коснитесь значка Мой Flow на стартовой странице или коснитесь трехточечного меню и выберите Мой Flow.
  • Нажмите кнопку «Подключить компьютер» и отсканируйте QR-код.

Чтобы отсканировать код с помощью Opera Touch для Android:

  • Нажмите на адресную строку поиска на стартовой странице.
  • Нажмите значок QR-кода в правой части строки.

Отправление сайта через My Flow

Отправьте нужный сайт, нажав кнопку Мой Flow в правой части адресной строки.

Отправление документов или фотографий через Мой Flow

Чтобы поделиться своими изображениями, документами или другими файлами, вы можете просто перетащить их в Мой Flow на своем компьютере или нажать кнопку загрузки и перейти к файлам на своем устройстве. На данный момент My Flow может сохранять и обмениваться файлами размером до 10 МБ, файлы исчезнут автоматически через 48 часов.

Получение контента с других подключенных устройств в Мой Flow

Небольшой значок уведомления появляется на Боковой панели на иконке Мой Flow при отправке нового контента. В Мой Flow появляется новый контент с информацией об устройстве, которое его отправило, и отметкой времени его прибытия.

Взаимодействие с контентом в Мой Flow

Ссылки на веб-контент, видео и другие медиафайлы в My Flow могут быть открыты в новой вкладке или доступны непосредственно там. Вы также можете скопировать веб-адрес страницы или заметку в буфер обмена вашего устройства.

Открытие в новой вкладке

Чтобы открыть содержимое из Мой Flow в новой вкладке, коснитесь изображения предварительного просмотра или названия сайта.

Воспроизведение мультимедиа в Мой Flow

Медиа, например видео на YouTube, можно воспроизводить в My Flow. Нажмите на встроенный медиа-файл, чтобы воспроизвести его.

Копирование в Мой Flow

Весь контент в Мой Flow можно скопировать в буфер обмена вашего устройства. Нажмите и удерживайте элемент, чтобы открыть всплывающую кнопку, затем нажмите «Копировать».

Удаление контента из Мой Flow

Ссылки, видео, фотографии или заметки в My Flow могут быть удалены по отдельности или полностью.

Чтобы удалить отдельный элемент из Мой Flow:

  • Перейдите к Мой Flow.
  • Нажмите и удерживайте изображение предварительного просмотра страницы или значок устройства рядом с элементом, который вы хотите удалить для мобильного устройства, для компьютера нажмите на 3 точки возле нужного контента.
  • Нажмите «Удалить» во всплывающем окне.

Чтобы удалить весь контент из Мой Flow:

  • Перейдите в настройки.
  • В разделе «Очистить Мой Flow» нажмите «Очистить».

Если новое содержимое, отправленное в Мой Flow, не отображается на панели, вам может потребоваться обновить или сбросить Мой Flow. Чтобы обновить Мой Flow, нажмите на кнопку обновления в правой верхней части панели.

Если обновление не помогло, вам может потребоваться аварийный сброс. Нажмите на меню из 3 точек и нажмите Аварийный сброс.

После аварийного сброса вам необходимо повторно подключить Мой Flow к Opera Touch.

Поиск по вкладкам

Инструмент «Поиск по вкладкам» – это простой способ найти нужную открытую вкладку, если их много в одном окне. Нажмите Ctrl + Пробел, чтобы вызвать инструмент, и начните вводить ключевое слово вкладки, чтобы идентифицировать вкладку. Список будет обновляться и сужать варианты вкладок по мере ввода. Также вы найдете в «Поиск по вкладкам» недавно закрытые вкладки. 

Вы также можете открыть «Поиск по вкладкам», щелкнув на значок увеличительного стекла справа от вкладок. Этот значок заменяет предыдущее меню вкладки.

Crypto Wallet

Opera – первый крупный браузер, который интегрировал собственный крипто-кошелек. Кошелек на основе Ethereum делает Opera способной исследовать Web 3.0, а также позволяет совершать транзакции с криптовалютой и токенами и предметами коллекционирования.

Кошелек Opera Crypto Wallet впервые был запущен в Opera для Android в июле 2018 года и был добавлен в Opera Touch для iOS в июне 2019 года. Opera для компьютеров может синхронизироваться с вашим Crypto Wallet, позволяя отправлять и получать криптовалюту, исследовать Web 3.0 и управлять своими коллекционными предметами и токенами, совместимыми с ERC20, непосредственно из браузера компьютера. Боковая панель Crypto Wallet синхронизируется с вашим Crypto Wallet Opera для Android или Opera Touch для iOS.

Вы можете совершать транзакции с помощью боковой панели Crypto Wallet на Opera для компьютеров и подтверждать платеж с помощью браузера Opera для Android или Opera Touch для iOS.

Ваши ключи, предметы коллекционирования и токены в вашем Opera Crypto Wallet доступны как на вашем компьютере Opera, так и в мобильных браузерах. Ключи вашего кошелька и его резервная фраза никогда не покидают ваш телефон и сохраняются в памяти вашего устройства.

Создание Opera Crypto Wallet

Прежде чем использовать Crypto Wallet на боковой панели в Opera для компьютеров, вам необходимо создать собственный Crypto Wallet в браузере Opera для Android или Opera Touch для iOS.

Чтобы создать крипто кошелек в Opera для Android:

  • Откройте браузер Opera для Android и выберите меню в правом нижнем углу.
  • Выберите Настройки, затем Crypto Wallet.
  • Нажмите кнопку Открыть кошелек.

Ваш крипто кошелек готов. Теперь вы можете получить к нему доступ через меню браузера.

Чтобы создать Crypto Wallet в Opera Touch для iOS:

  • Откройте браузер Opera Touch на вашем устройстве iOS.
  • Коснитесь трехточечного меню в верхнем правом углу и выберите «Настройки».
  • Под Crypto Wallet, нажмите большую кнопку с надписью «Активировать».

Ваш Crypto Wallet готов. Теперь вы можете получить к нему доступ непосредственно из главного меню из трех точек.

Для вас будет создана резервная фраза из 12 слов, также известная как начальная фраза. Очень важно сохранить эту фразу в безопасности. Opera никогда не попросит вашу резервную фразу.

Если вы когда-нибудь потеряете свой телефон или он будет украден, что лишит вас доступа к вашему кошельку, с помощью этой фразы вы можете восстановить ваш кошелек.

Подключите ваш Crypto между вашим телефоном и Opera для компьютеров:

Для начала, вам нужно добавить Crypto Wallet на боковую панель Opera.

Чтобы добавить Crypto Wallet на боковую панель Opera:

  • Перейдите в Настройки браузера
  • Перейдите в раздел Возможности
  • Активируйте «Включить Crypto Wallet»

После этого Вы сможете подключить телефон к компьютеру. Чтобы это сделать:

  • Нажмите на иконку Crypto Wallet на боковой панели

Нажмите показать код на компьютере и сканируйте его с помощью мобильного устройства.

Если соединение установлено успешно, на вашем устройстве появится следующее всплывающее окно:

На боковой панели Crypto Wallet вы увидите денежные средства, токены и предметы коллекционирования вашего кошелька. Теперь вы можете использовать свой Crypto Wallet на вашем компьютере. Поздравляем!

Как совершить транзакцию с помощью Crypto Wallet на Opera для компьютеров?

Все транзакции, совершенные с вашим кошельком Opera Crypto, будь то покупка, отправка или получение от другого лица, должны быть подтверждены на вашим мобильном браузером Opera. Это двухэтапный процесс проверки, который помогает защитить ваши средства и сохранить ключи вашего кошелька в безопасности.

Когда вы будете готовы совершить транзакцию из Opera для компьютеров, откроется панель Crypto Wallet и начнется процесс подтверждения оплаты.

Чтобы продолжить процесс оплаты, откройте мобильный браузер Opera. Если ваш кошелек правильно синхронизирован, мобильный браузер откроет страницу подтверждения оплаты. Здесь вы можете просмотреть детали ожидающей покупки.

Чтобы продолжить транзакцию, нажмите «Подтвердить».

После нажатия кнопки «Подтвердить» вам будет предложено выполнить процедуру разблокировки системы вашего устройства.

Процесс оплаты завершен.

Если покупка не удалась, вы увидите экран, показанный ниже в браузере вашего компьютера. Вам нужно будет повторить попытку покупки.

Как я могу получить Ethereum (ETH)?

Чтобы получить Ethereum от отправителя, вам необходимо сообщить адрес своего кошелька.

На боковой панели Crypto Wallet щелкните Копировать адрес, чтобы скопировать адрес вашего кошелька в буфер обмена. Теперь вы можете вставить адрес в любую форму отправки / получения.

Что такое Opera в dApp?

Opera Crypto Wallet предоставляет прямую ссылку на Opera dApps Store. Здесь вы можете найти приложения для Web 3.0, такие, как CryptoKitties, Bitrefill и другие приложения и приложения для социальных сетей на основе Ethereum.

Чтобы открыть Opera dApps Store, откройте боковую панель Opera Crypto Wallet и нажмите синюю кнопку dApp в правом нижнем углу панели.

Посетите страницу часто задаваемых вопросов о Crypto Wallet, если у вас есть дополнительные вопросы о встроенном кошельке. Узнайте больше о Crypto Wallet для Opera для Android.

Изменение снимков экрана

После захвата снимка экрана отображаются инструменты изменения. Они включают масштабирование, стрелку, размытие, карандаш, селфи-камеру и эмодзи.

После завершения изменения снимка экрана вы можете выбрать Copy and Close (Копировать и закрыть) изображение или Save Image (Сохранить изображение).

При нажатии Copy and Close (Копировать и закрыть) изображение копируется в буфер обмена, позволяя вставить его в сообщение встроенных служб обмена сообщениями на боковой панели или документ.

Если вы хотите сохранить сообщение в системе, нажмите Save Image (Сохранить изображение). Изображение сохраняется в формате .png в выбранном вами расположении.

Пространства

Функция Пространства дает вам возможность упорядочить вкладки в браузере Opera, связанные с различными темами, например, работа, планирование путешествий или покупки. Вы можете сохранять вкладки, относящиеся к выбранной вами теме, в одной рабочем пространстве и не отвлекаться на вкладки, связанные с другой. Думайте о рабочих пространствах как о папках для вкладок – вы можете оставить их пустыми или заполнить.

Для переключения между рабочими пространствами используйте значки в верхней части боковой панели. Нажмите на значок, чтобы перемещаться между пространствами. Чтобы быстро включить/отключить значки пространств, щелкните правой кнопкой мыши на пустое место на боковой панели и выберите нужное пространство.

Вы также можете нажать на трехточечное меню в нижней части боковой панели, чтобы открыть панель настроек боковой панели. Это дает вам возможность:

  • Включить/выключить пространства:
    • Установите флажок напротив Пространств
  • Добавить больше пространств (максимально 5):
    • Нажмите Добавить, рядом со значком +
  • Отредактируйте значок или название пространства:
    • Нажмите на значок с тремя точками рядом с пространством
    • Выберите Изменить
  • Удалить пространство:
    • Нажмите на значок с тремя точками рядом с пространством
    • Выберите Удалить
  • Скрыть пространство:
    • Нажмите на синюю галочку, чтобы скрыть нужное пространство
    • Нажмите еще раз, чтобы его активировать

Чтобы перенести вкладку в другое пространство (вы также можете с помощью нажатия Shift перенести несколько вкладок):

  • Щелкните правой кнопкой на нужную вкладку, чтобы открыть Контекстное Меню вкладки
  • Выберите Переместить вкладку в пространство…
  • Выберите место назначения

Другие элементы контекстного меню вкладки влияют только на текущее пространство. Например, если вы выберете Обновить все вкладки, будут обновлены только те вкладки, которые находятся в вашем текущем пространстве. Точно так же, если вы хотите переключаться между своими вкладками используя сочетание Ctrl + Tab, вы будете переключаться только между вкладками в текущем пространстве.

Как это работает?
Если Вы посетили сайт Booking.com и просмотрели как минимум три отеля, браузер Opera создаст раздел Открыть на Booking.com на Вашей стартовой странице, отображая недавно просмотренные Вами отели.

Отправляет ли секция историю моих просмотров?
Opera не отправляет Вашу историю просмотра на сайте Booking.com на сервер Opera. Продолжить Booking работает только в пределах вашего браузера, без просмотра вашего IP, и отображается только для активных пользователей Booking.com, которые просмотрели как минимум три разных места проживания.

Как я могу спрятать или отключить секцию “Продолжить покупки”?
Чтобы выключить эту функцию, нажмите на x и выберите Не показывать снова или Напомнить позже, чтобы вернуться к бронированию через некоторое время.

Продолжить покупки на стартовой странице


Как это работает?
Если Вы посетили сайты Amazon.com, Aliexpress.com или Otto.de и просмотрели как минимум три товара, браузер Opera создаст раздел Продолжить покупки на Вашей стартовой странице, отображая недавно просмотренные Вами товары.

Отправляет ли секция историю моих просмотров?
Opera не отправляет Вашу историю просмотра на сайтах Amazon или AliExpress на сервер Opera. Продолжить покупки работает только в пределах вашего браузера, без просмотра вашего IP, и отображается только для активных пользователей Amazon или AliExpress, которые просмотрели как минимум три разных товара.

Как я могу спрятать или отключить секцию “Продолжить покупки”?
Чтобы выключить эту функцию, нажмите на x и выберите Не показывать снова или Напомнить позже, чтобы вернуться к покупке через некоторое время.

Улучшенная адресная строка (BABE)

Функция BABE (Улучшенная адресная строка) – это полезное всплывающее окно, которое появляется при нажатии на адресную строку. Оно обеспечивает быстрый доступ к:

  • Сайтом, которые вы часто посещаете
  • Экспресс-панели
  • Рекомендациям
  • Новым закладкам
  • Полезным страницам браузера

Чтобы включить или отключить эту функцию:

  1. Перейдите к Настройкам
  2. На левой боковой панели нажмите Дополнительно, затем нажмите Браузер.
  3. Прокрутите вниз до раздела “Интерфейс пользователя“.
  4. Нажмите Показывать улучшенную адресную строку.

Чтобы удалить элемент:

  1. Наведите указатель мыши на элемент, и щелкните значок с тремя точками (…)
  2. Нажмите Отменить

Вы можете изменить размер плиток Экспресс-панели, отображаемых в этой функции, щелкнув на значок плиток в правом верхнем углу всплывающего окна. Чтобы закрыть всплывающее окно, нажмите X, а затем – Скрыть расширенную адресную строку.

Эта функция показывает вам плитки и рекомендации на основе вашего опыта просмотра поэтому если вы только начали использовать Opera, для отображения этой функции может потребоваться некоторое время. Просто продолжайте просмотр, и она скоро появится.

Время для 30-секундного рекламного ролика уходит | Alan Wolk

30-секундный телевизионный рекламный ролик, который когда-то был точкой соприкосновения с культурой, потерял свою актуальность в современном мире. Он обречен на то, чтобы быть отправленным на свалку артефактов 20-го века, прямо там, где есть кассетные плееры и телефонные номера.

Расцвет телерекламы пришелся на 1960-е годы, когда у людей был избыток времени, особенно по вечерам после работы. Не было электронных писем, текстовых сообщений или социальных сетей, за которыми следовало бы следить.Работа и жизнь имели четкие границы, и телевидение ограничивалось несколькими станциями, которые вещали только в определенное время дня.

Рекламные ролики были частью телешоу, окном в новый мир упакованных товаров, автомобилей и авиаперелетов. Они были эффективным способом узнать об этих продуктах, не вставая с дивана.

Это уже не так. Для современного потребителя, имеющего доступ к Интернету, телевизионная реклама, возможно, является наименее эффективным способом узнать о продукте.Это 30 секунд продажи, когда все, что мы действительно хотим сделать, это просто сесть и посмотреть наше шоу.

Функция сдвига времени позволила нам сделать просмотр телевизора всего лишь еще одним запланированным занятием в наших уже упакованных дневниках. Дело не в том, что мы не хотим получать известия от брендов, просто мы не хотим ничего слышать от них в то время, которое мы отводили для просмотра телевизора.

Отсюда недавняя популярность термина «прерывающая реклама», проклятого прозвища, если оно когда-либо существовало.Люди не хотят, чтобы их отвлекала реклама. Они хотят взаимодействовать с ним на своих условиях, когда они находятся в потребительском режиме и, следовательно, в правильном мышлении, чтобы прислушиваться к сообщениям бренда.

В результате всего этого телевизионные рекламные ролики кажутся пережитками более простой эпохи, когда вся семья собиралась вокруг телевизора каждую ночь, чтобы смотреть ограниченный набор программ без возможности паузы, быстрой перемотки вперед, назад и т.д. проверьте Facebook, проверьте Twitter, поищите что-нибудь в Интернете или отправьте текстовое сообщение.Они определенно не похожи на 2015 год, и статистика показывает, что зрители их старательно избегают.

Проведенное в прошлом году Arris исследование показало, что 84% респондентов хотели быстро перемотать просматриваемую рекламу, в то время как 60% из них скачивают или записывают передачи, чтобы можно было пропустить рекламу. Даже реклама Суперкубка потеряла свою эффективность: исследование 2014 года показало, что 80% из них не увеличивают продажи компаний, которые ими управляют.

Рост использования смартфонов и планшетов также снижает актуальность телевизионных рекламных роликов.В прошлом месяце исследователи обнаружили, что зрители, которые смотрели только на экран телевизора, могли вспомнить 2,43 из каждых трех упомянутых брендов, в то время как пользователи смартфонов и планшетов смогли вспомнить только 1,62 в среднем.

Благодаря Интернету реклама даже теряет свою роль в качестве источника информации: исследование, проведенное Mindshare в начале этого года, показало, что процент американцев, заявивших, что реклама помогает им узнавать о товарах и услугах, снизился с 52% в 2005 году до 41%. в 2014.

Итак, какое сообщение бренда уместно сегодня? Что может сделать бренд, чтобы донести свое послание до потребителей в этой новой медиа-среде, не отказываясь от огромного охвата, который может дать телевизионная реклама?

Ответ пока неясен, но лучше всего начать с брендированного контента или нативной рекламы. Спонсируя программы, зритель может захотеть смотреть их исключительно ради развлечения, поэтому послание бренда не будет таким обременительным. Акцент здесь делается на развлечениях и на использовании голоса сайта или сети, в которой транслируется программа.Послание бренда не похоронено, но и не находится в центре внимания — компромисс, с которым все еще борются многие маркетологи. Брендированный контент и нативная реклама доказали свою эффективность в Интернете, например на Buzzfeed, и нет оснований полагать, что он не будет эффективно транслироваться на телевидение, где зрители будут активно взаимодействовать с ним, в отличие от пассивного опыта, который у них есть на телевидении старой школы. рекламные ролики.

Другой вариант — смириться с тем фактом, что многие (если не большинство) зрителей смотрят телевизор по своему собственному расписанию, и начать относиться к шоу как к кинофильмам.Это означает ограничение рекламы только рекламой в начале ролика, где она с меньшей вероятностью будет восприниматься как раздражающая или мешающая, поскольку появляется до того, как зритель успевает принять участие в шоу. За ним даже может последовать страница на веб-сайте шоу со списком «спонсоров» (который звучит лучше, чем рекламодатели) со ссылками, которые позволяют зрителю более глубоко взаимодействовать с брендом, от загрузки купонов до просмотра. демонстрация прямой электронной коммерции.

Телевизионные рекламные ролики не исчезнут в одночасье — они все еще слишком эффективны — и не исчезнут по всем обычным причинам: «Телевидение умерло, Интернет — король».Они исчезнут, потому что у современного потребителя больше нет терпения просидеть четырехминутный пакет из восьми 30-секундных рекламных презентаций. В результате их эффективность постепенно ослабеет, и они останутся артефактами для историков, изучающих вторую половину 20-го века.

Алан Волк — консультант по вопросам бизнеса и будущего телевидения, а — старший аналитик TDG . Следуйте за ним в Twitter @awolk . Он только что выпустил книгу Over the top: как Интернет (медленно, но верно) меняет телеиндустрию .

Чтобы получать еженедельный анализ новостей, оповещения о вакансиях и уведомления о событиях прямо на ваш почтовый ящик, зарегистрируйтесь бесплатно для членства в Media Network .

Весь контент Guardian Media Network является редакционно независимым, за исключением материалов с пометкой «Принесено вам» — подробнее здесь .

Работа оптических атомных часов с подсистемой лазера Бриллюэна

  • 1.

    Hinkley, N. et al. Атомные часы с нестабильностью 10 −18 . Наука 341 , 1215–1218 (2013).

    ADS CAS PubMed Google ученый

  • 2.

    Bloom, B.J. et al. Часы на оптической решетке с точностью и стабильностью на уровне 10 −18 . Природа 506 , 71–75 (2014).

    ADS CAS Google ученый

  • 3.

    Брюэр, С. М. и др. 27 Al + квантово-логические часы с систематической погрешностью ниже 10 −18 . Phys. Rev. Lett . 123 , 033201 (2019).

    ADS CAS Google ученый

  • 4.

    Koller, S. B. et al. Переносные оптические часы на решетке с погрешностью 7 × 10 −17 . Phys. Rev. Lett . 118 , 073601 (2017).

    ADS CAS PubMed Google ученый

  • 5.

    Годун, Р. М. и др. Отношение частот двух оптических часовых переходов в 171 Yb + и ограничения на изменение во времени фундаментальных констант. Phys. Rev. Lett . 113 , 210801 (2014).

    ADS CAS PubMed Google ученый

  • 6.

    Huntemann, N., Sanner, C., Lipphardt, B., Tamm, Chr. И Пейк, Э. Одноионные атомные часы с систематической неопределенностью 3 × 10 −18 . Phys. Rev. Lett . 116 , 063001 (2016).

    ADS CAS PubMed Google ученый

  • 7.

    Лейбрандт, Д. Р., Торп, М. Дж., Бергквист, Дж. К. и Розенбанд, Т. Полевые испытания надежного портативного лазера со стабильной частотой. Опт. Экспресс 19 , 10278–10286 (2011).

    ADS PubMed Google ученый

  • 8.

    Лю Л.и другие. Орбитальная работа атомных часов на базе лазерного охлаждения 87 Rb. Nat. Коммуна . 9 , 2760 (2018).

    ADS PubMed PubMed Central Google ученый

  • 9.

    Takamoto, M. et al. Проверка общей теории относительности парой переносных часов на оптической решетке. Nat. Фотон. 14 , 411–415 (2020).

    ADS CAS Google ученый

  • 10.

    Maleki, L. & Prestage, J. Приложения часов и эталонов частоты: от рутинных к испытаниям фундаментальных моделей. Метрология 42 , S145 – S153 (2005).

    ADS Google ученый

  • 11.

    Ладлоу, А. Д., Бойд, М. М., Йе, Дж., Пейк, Э. и Шмидт, П. О. Оптические атомные часы. Ред. Мод. Phys . 87 , 637–701 (2015).

    ADS CAS Google ученый

  • 12.

    McGrew, W. F. et al. Производительность атомных часов, позволяющая выполнять геодезию ниже сантиметрового уровня. Природа 564 , 87–90 (2018).

    ADS CAS PubMed Google ученый

  • 13.

    Янг Б. К., Круз Ф. К., Итано В. М. и Бергквист Дж. С. Лазеры видимого диапазона с субгерцовой шириной линии. Phys. Rev. Lett . 82 , 3799–3802 (1999).

    ADS CAS Google ученый

  • 14.

    Jiang, Y. Y. et al. Повышение стабильности оптических атомных часов с помощью лазерной стабилизации на уровне 10 −16 . Nat. Фотон . 5 , 158–161 (2011).

    ADS CAS Google ученый

  • 15.

    Kessler, T. et al. Лазер с шириной линии менее 40 мГц на основе кремниевого монокристаллического оптического резонатора. Nat. Фотон . 6 , 687–692 (2012).

    ADS CAS Google ученый

  • 16.

    Davila-Rodriguez, J. et al. Компактный эталонный резонатор с ограниченным тепловым шумом для сверхмалошумящего микроволнового излучения. Опт. Lett . 42 , 1277–1280 (2017).

    ADS CAS PubMed Google ученый

  • 17.

    Didier, A. et al. Сверхкомпактная эталонная стеклянная полость со сверхнизким расширением. Заявл. Опция . 57 , 6470–6473 (2018).

    ADS CAS PubMed Google ученый

  • 18.

    Грудинин И.С., Мацко А.Б., Малеки Л. Лазерная генерация Бриллюэна с резонатором на моде шепчущей галереи из CaF 2 . Phys. Rev. Lett . 102 , 043902 (2009).

    ADS PubMed Google ученый

  • 19.

    Lee, H. et al. Химически травленный клиновой резонатор сверхвысокого давления Q на кремниевом кристалле. Nat. Фотон . 6 , 369–373 (2012).

    ADS CAS Google ученый

  • 20.

    Кабакова И.В. и др. Узкополосный лазер Бриллюэна на основе халькогенидного фотонного чипа. Опт. Lett . 38 , 3208–3211 (2013).

    ADS CAS PubMed Google ученый

  • 21.

    Loh, W. et al. Лазер Бриллюэна с двумя микрорезонаторами и узкой шириной линии. Optica 2 , 225–232 (2015).

    ADS CAS Google ученый

  • 22.

    Оттерстром, Н. Т., Бехунин, Р. О., Киттлаус, Э. А., Ван, З. и Ракич, П. Т. Кремниевый лазер Бриллюэна. Наука 360 , 1113–1116 (2018).

    ADS MathSciNet CAS PubMed МАТЕМАТИКА Google ученый

  • 23.

    Gundavarapu, S. et al. Интегрированный фотонный лазер Бриллюэна с субгерцовой основной шириной линии. Nat. Фотон . 13 , 60–67 (2019).

    ADS CAS Google ученый

  • 24.

    Geng, J. et al. Высокостабильный малошумящий волоконный лазер Бриллюэна со сверхузкой спектральной шириной линии. IEEE Photonics Technol. Lett . 18 , 1813–1815 (2006).

    ADS Google ученый

  • 25.

    Ши, Ю. Г., Аль-Мансури, М. Х., Исмаил, А., Хитам, С. и Махди, М. А. Многоволновой бриллюэно-эрбиевый волоконный лазер с двойным интервалом между частотами Бриллюэна. Опт. Экспресс 19 , 1699–1706 (2011).

    ADS CAS PubMed Google ученый

  • 26.

    Tow, K. H. et al. Сужение ширины линии и снижение интенсивности шума стоксовой компоненты 2-го порядка низкопорогового лазера Бриллюэна на основе халькогенидного волокна Ge 10 As 22 Se 68 . Опт. Экспресс 20 , B104 – B109 (2012).

    CAS PubMed Google ученый

  • 27.

    Дебют А., Ранду С. и Земмури Дж. Сужение ширины линии в лазерах Бриллюэна: теоретический анализ. Phys. Ред. A 62 , 023803 (2000).

    ADS Google ученый

  • 28.

    Ло, В., Егнанараянан, С., О’Доннелл, Ф. и Юодолкис, П. В. Лазер Бриллюэна со сверхузкой шириной линии и саморегулированием температуры нанокельвина. Оптика 6 , 152–159 (2019).

    ADS CAS Google ученый

  • 29.

    Джеффертс, С. Р., Микхоф, Д. М., Ширли, Дж. Х., Степанович, М. и Паркер, Т. Е. Точность определяется на основе первичного цезиевого эталона частоты с лазерным охлаждением NIST-F1. В Proc. IEEE / EIA Int. Симпозиум и выставка по контролю частоты 714–717 (IEEE, 2000).

  • 30.

    Madej, AA, Dubé, P., Zhou, Z., Bernard, JE & Gertsvolf, M. 88 Sr + Одноионный эталонный сигнал 445 ТГц на уровне 10 −17 посредством контроля и отмены систематических погрешностей и их измерения относительно секунды СИ. Phys. Rev. Lett . 109 , 203002 (2012).

    ADS PubMed Google ученый

  • 31.

    Стрекалов Д. В., Томпсон Р. Дж., Баумгартель Л. М., Грудинин И. С. и Ю. Н. Измерение и стабилизация температуры в резонаторе с двойным лучепреломлением в режиме шепчущей галереи. Опт. Экспресс 19 , 14495–14501 (2011).

    ADS CAS PubMed Google ученый

  • 32.

    Фещенко И. и др. Метод двухрежимной температурной компенсации для стабилизации лазера в кристаллическом резонаторе с модой шепчущей галереи. Опт. Экспресс 20 , 19185–19193 (2012).

    ADS CAS PubMed Google ученый

  • 33.

    Weng, W. et al. Нанокельвиновая термометрия и контроль температуры: за пределами теплового шума. Phys. Rev. Lett . 112 , 160801 (2014).

    ADS PubMed Google ученый

  • 34.

    Lim, J. et al. Исследование стабильности 10 мкК и остаточных дрейфов при кросс-поляризационной двухрежимной стабилизации монокристаллических сверхвысоких оптических резонаторов Q . Light Sci. Заявление . 8 , 1 (2019).

    ADS PubMed PubMed Central Google ученый

  • 35.

    Drever, R. W. P. et al. Стабилизация фазы и частоты лазера с помощью оптического резонатора. Заявл. Phys. В 31 , 97–105 (1983).

    ADS Google ученый

  • 36.

    Сторц Р., Браксмайер К., Як К., Прадл О. и Шиллер С. Сверхвысокая долговременная стабильность размеров сапфирового криогенного оптического резонатора. Опт. Lett . 23 , 1031–1033 (1998).

    ADS CAS PubMed Google ученый

  • 37.

    Bruzewicz, C. D., McConnell, R., Chiaverini, J. & Sage, J.М. Масштабируемая загрузка двумерного массива захваченных ионов. Nat. Коммуна . 7 , 13005 (2016).

    ADS CAS PubMed PubMed Central Google ученый

  • 38.

    Ван, С. X., Лабазевич, Дж., Ге, Й., Шевмон, Р. и Чуанг, И. Л. Демонстрация квантового логического элемента в криогенной ионной ловушке с поверхностным электродом. Phys. Ред. A 81 , 062332 (2010).

    ADS Google ученый

  • 39.

    Ма, Л. С., Юнгер, П., Йе, Дж. И Холл, Дж. Л. Обеспечение одинаковой оптической частоты в двух местах: точное подавление фазового шума, вносимого оптическим волокном или другим изменяющимся во времени трактом. Опт. Lett . 19 , 1777–1779 (1994).

    ADS CAS PubMed Google ученый

  • 40.

    Nicholson, T. L. et al. Сравнение двух независимых оптических часов Sr со стабильностью 1 × 10 −17 при 10 3 с. Phys. Rev. Lett . 109 , 230801 (2012).

    ADS CAS PubMed PubMed Central Google ученый

  • 41.

    Nicholson, T. L. et al. Систематическая оценка атомных часов при неопределенности 2 × 10 −18 . Nat. Коммуна . 6 , 6896 (2015).

    ADS CAS PubMed PubMed Central Google ученый

  • 42.

    Dubé, P. et al. Отмена электрического квадрупольного сдвига в одноионных оптических стандартах частоты. Phys. Rev. Lett . 95 , 033001 (2005).

    ADS PubMed Google ученый

  • 43.

    Spencer, D. T. et al. Оптический синтезатор частоты с использованием интегрированной фотоники. Природа 557 , 81–85 (2018).

    ADS CAS PubMed Google ученый

  • 44.

    Liang, W. et al. Миниатюрный полупроводниковый лазер со сверхнизким шумом и внешним резонатором. Nat. Коммуна . 6 , 7371 (2015).

    ADS CAS PubMed PubMed Central Google ученый

  • 45.

    Zhang, W. et al. Фотонно-атомный лазер со сверхузкой шириной линии. Laser Photonics Ред. . 14 , 1
    3 (2020).

    ADS CAS Google ученый

  • 46.

    Howe, D. A. Подход с использованием полного отклонения для долгосрочной характеристики стабильности частоты. IEEE Trans. Ультразвуковой. Сегнетоэлектр. Freq. Контроль 47 , 1102–1110 (2000).

    CAS PubMed Google ученый

  • 47.

    Chang, L. et al. Гетерогенная интеграция волноводов из ниобата лития и нитрида кремния для полупроводниковых фотонных интегральных схем на кремнии. Опт. Lett . 42 , 803–806 (2017).

    ADS CAS PubMed Google ученый

  • 48.

    Хьельме Д. Р., Микельсон А. Р. и Босолей Р. Г. Стабилизация полупроводникового лазера с помощью внешней оптической обратной связи. IEEE J. Quantum Electron . 27 , 352–372 (1991).

    ADS CAS Google ученый

  • 49.

    Акерман Н., Навон Н., Котлер С., Гликман Ю. и Озери Р.Универсальный вентильный блок для кубитов с захваченными ионами с использованием диодного лазера с узкой шириной линии. Нью Дж. Физика . 17 , 113060 (2015).

    ADS Google ученый

  • 50.

    Камминс, Х. К., Ллевеллин, Г. и Джонс, Дж. А. Устранение систематических ошибок в квантовых логических вентилях с помощью составных вращений. Phys. Ред. A 67 , 042308 (2003).

    ADS Google ученый

  • Большие Страсбургские часы — точная копия оригинальных Апостольских, музыкальных и астрономических часов

    Подробнее об авторских правах и других ограничениях

    Для получения рекомендаций по составлению полных цитат обратитесь к Ссылаясь на первоисточники.

    • Консультации по правам человека : Нет известных ограничений на воспроизведение.
    • Номер репродукции : LC-USZ62-57817 (ч / б пленка, копия негр.)
    • Телефонный номер : ЛОТ 10677 [товар] [P&P]
    • Консультации по доступу : —

    Получение копий

    Если изображение отображается, вы можете скачать его самостоятельно.(Некоторые изображения отображаются только в виде эскизов за пределами Библиотеке Конгресса США из-за соображений прав человека, но у вас есть доступ к изображениям большего размера на сайт.)

    Кроме того, вы можете приобрести копии различных типов через Услуги копирования Библиотеки Конгресса.

    1. Если отображается цифровое изображение: Качество цифрового изображения частично зависит от того, был ли он сделан из оригинала или промежуточного звена, такого как копия негатива или прозрачность.Если вышеприведенное поле «Номер воспроизведения» включает номер воспроизведения, который начинается с LC-DIG …, то есть цифровое изображение, сделанное прямо с оригинала и имеет достаточное разрешение для большинства публикационных целей.
    2. Если есть информация, указанная в поле «Номер репродукции» выше: Вы можете использовать номер репродукции, чтобы купить копию в Duplication Services. Это будет составлен из источника, указанного в скобках после номера.

      Если указаны только черно-белые («черно-белые») источники, и вы хотите, чтобы копия показывала цвет или оттенок (если они есть на оригинале), вы обычно можете приобрести качественную копию оригинал в цвете, указав номер телефона, указанный выше, и включив каталог запись («Об этом элементе») с вашим запросом.

    3. Если в поле «Номер репродукции» выше нет информации: Как правило, вы можете приобрести качественную копию через Службу тиражирования.Укажите номер телефона перечисленных выше, и включите запись каталога («Об этом элементе») в свой запрос.

    Прайс-листы, контактная информация и формы заказа доступны на Веб-сайт службы дублирования.

    Доступ к оригиналам

    Выполните следующие действия, чтобы определить, нужно ли вам заполнять квитанцию ​​о звонках в Распечатках. и Читальный зал фотографий для просмотра оригинала (ов). В некоторых случаях суррогат (замещающее изображение) доступны, часто в виде цифрового изображения, копии или микрофильма.

    1. Товар оцифрован? (Уменьшенное (маленькое) изображение будет видно слева.)

      • Да, товар оцифрован. Пожалуйста, используйте цифровое изображение вместо того, чтобы запрашивать оригинал. Все изображения могут быть смотреть в большом размере, когда вы находитесь в любом читальном зале Библиотеки Конгресса. В некоторых случаях доступны только эскизы (маленькие) изображения, когда вы находитесь за пределами библиотеки Конгресс, потому что права на товар ограничены или права на него не оценивались. ограничения.
        В качестве меры по сохранности мы обычно не обслуживаем оригинальный товар, когда цифровое изображение доступен. Если у вас есть веская причина посмотреть оригинал, проконсультируйтесь со ссылкой библиотекарь. (Иногда оригинал слишком хрупкий, чтобы его можно было использовать. Например, стекло и пленочные фотографические негативы особенно подвержены повреждению. Их также легче увидеть в Интернете, где они представлены в виде положительных изображений.)
      • Нет, товар не оцифрован. Перейдите к # 2.
    2. Указывают ли указанные выше поля Консультативного совета по доступу или Номер вызова, что существует нецифровой суррогат, типа микрофильмов или копий?

      • Да, существует еще один суррогат. Справочный персонал может направить вас к этому суррогат.
      • Нет, другого суррогата не существует. Перейдите к # 3.
    3. Если вы не видите миниатюру или ссылку на другого суррогата, заполните бланк звонка. Читальный зал эстампов и фотографий. Во многих случаях оригиналы могут быть доставлены в течение нескольких минут. Другие материалы требуют записи на более позднее в тот же день или в будущем. Справочный персонал может посоветуют вам как заполнить квитанцию ​​о звонках, так и когда товар может быть подан.

    Чтобы связаться со справочным персоналом в Зале эстампов и фотографий, воспользуйтесь нашей Спросите библиотекаря или позвоните в читальный зал с 8:30 до 5:00 по телефону 202-707-6394 и нажмите 3.

    Информационный бюллетень для коллекционеров будильников Лето 2012

    Сентябрь 2012 Послание Президента

    ВСЕМ ПРИВЕТСТВИЕ

    Президент Боб Линкенхокер перед стендом

    Как вы все знаете, Национальное собрание 2012 года подошло к концу.После мероприятия я сделал небольшой перерыв, чтобы отдохнуть, но снова в норме. У нас действительно было собрание Главы 178 в субботу утром на съезде. Присутствовали члены отделения Боб и Кора Ли Линкенхокеры, Винс и Филлис Энджелл, Деннис Сагволд, Ларри и Мэри Ле Кнудсен, а также гости Билли и Рут Джонсон, которые дружат с участником Джин Бейкер. Вы можете прочитать полные протоколы собрания в разделе «Основные моменты» в журнале «Март за сентябрь / октябрь». Я хочу поблагодарить Филлис за то, что она делала заметки и составляла протокол.Помимо собрания главы, Винс и Филлис на протяжении всего съезда устраивали в торговом зале большой будильник. В целом, я бы оценил съезд как успешный и довольно интересный. Я призываю всех тех, кто может участвовать в национальных конвенциях, сделать это. Я уверен, что вы не пожалеете об этом.

    Картинки из каталогов Уорда

    Надежная реклама будильника на 40 часов.

    Эти изображения и связанный с ними текст были взяты из различных каталогов Уорда (по крайней мере, я считаю, что это правда) более ранних лет.Прочтите текст, чтобы получить представление о торговых точках, которые использовались для продвижения этих товаров.

    У меня нет данных о годах, но посмотрите на цены, и вы получите представление.

    У меня вопрос: «Кто-нибудь знает, кто был крупным производителем часов, с которым Уорд заключил контракт на производство старых надежных и надежных часов»? Также Reliable является устаревшей версией Old Reliable или просто последним продуктом. Я видел эти продукты в продаже в местных магазинах, но, поскольку я лично специализируюсь на Westclox, я не уделял им особого внимания.Это обязательно изменится в будущем.

    Прочтите текст для немецкой сигнализации. Похоже, что при цене 49 центов они на самом деле не продавали эту продукцию, а скорее показали ее в сравнении с продукцией, произведенной в Америке. Воспоминание о более раннем времени, когда американские товары ценились выше иностранных конкурентов.

    Включен еще один лист с инструкциями по установке восьмидневного будильника по национальному вызову, произведенного Э. Инграмом.

    Еще один интересный момент.Несмотря на то, что Montgomery Wards претерпела множество изменений в своей жизни и в конце 20 -го века закрыла все свои розничные магазины, даже переживая банкротство, сегодня она существует как интернет-магазин. Введите в браузере «Montgomery Wards» и посмотрите, что произойдет. Надеюсь, они вам будут интересны. — Боб Линкенхокер

    Деннис Сагволд останавливался у нашего дома в августе и привез немало копий материалов из своего архива ранней рекламы будильников.Из этих объявлений можно многое узнать о том, что предлагалось на продажу, и о ценах с начала 20-го -го века -го. Это те предметы, которые использовали бы наши родители, бабушки и дедушки, и цены, которые они платили бы за них, конечно, заработная плата была не такой, как сегодня. Ознакомьтесь с информацией далее в этом информационном бюллетене для некоторых из этих интересных данных. Я буду включать больше этого материала в будущие письма.

    Как всегда желаю всем крепкого здоровья, а также удачного и удачного сбора.До следующего раза ваш покорный слуга. — Боб Линкенхокер (Все 16 печатных рекламных объявлений, упомянутых выше, можно найти, загрузив здесь информационный бюллетень HBACC за лето 2012 г. -> [download id = ”32 ″]

    Новые часы: эпигенетические митотические часы | Genome Biology

    Янга и его коллег [4] следует поздравить за объединение передовых биологических знаний с современной биоинформатикой в ​​построении модели прогнозирования рака. Изучение этой провокационной модели обязательно приведет к ее модификациям и уточнениям, поскольку основные предположения (как модели, так и прошлые эксперименты) оспариваются, а понимание лежащей в основе биологии улучшается.Вначале отметим, что в этой работе есть несколько важных допущений и ограничений.

    Во-первых, скорости деления стволовых клеток, применяемые в этой работе, взяты из представленных у Tomasetti и Vogelstein [6]. Хотя это разумно, как указывают Томазетти и Фогельштейн в своей работе [6], есть возможности для улучшения представленных ими оценок. Кроме того, текущая модель тестируется на раковых тканях и показывает повсеместное увеличение, но авторы еще не представили доказательств прогнозирования риска в перспективных условиях, где доступность данных все еще очень ограничена.Текущая модель не включает и не применяет оценки того вклада, который соматические изменения в не стволовых клетках (в любой ткани или тканевой среде) могут внести в частоту клещей. Измененные соматические клетки, особенно в тканях с более высоким уровнем воздействия канцерогенов, могут иметь не стволовые клетки, которые распространяют изменения и увеличивают предполагаемую скорость тика митотических часов. Мы также отмечаем здесь, что потенциальный вклад иммунитета и воспаления, которые особенно важны для многих солидных опухолей, еще специально не включен в модель.Текущая модель также построена, соответственно, с использованием данных только из одного источника ткани, и дополнительные данные о метилировании из нормальных тканей здоровых субъектов необходимы для расширения и дальнейшего изучения прогнозов модели. И, наконец, подходы, не содержащие эталонов и основанные на эталонах, должны быть должным образом применены для корректировки клеточной гетерогенности в условиях различных других типов нормальных тканей.

    Мы также подчеркиваем, что, как отмечают авторы, эта модель обязательно предполагает, что метилирование в информативных локусах происходит только в стволовых клетках.Это новая биология, в пользу которой практически нет экспериментальных доказательств. Если это правда, это будет означать, что специфичность локуса в метилировании по-разному определяется в многочисленных отдельных клеточных и тканеспецифичных компартментах.

    HD обои: реклама, текст, часы, нет людей, бизнес, время, общение

    HD обои: реклама, текст, часы, нет людей, бизнес, время, общение | Обои Flare реклама, текст, часы, нет людей, бизнес, время, общение, HD обои Информация об оригинальных обоях: Размер изображения: 2678x1785px Размер файла: 1.43 МБ WallpaperFlare — это открытая платформа, на которой пользователи могут делиться своими любимыми обоями. Загружая эти обои, вы соглашаетесь с нашими Условиями использования и Политикой конфиденциальности. Это изображение предназначено только для использования в качестве обоев рабочего стола. Если вы являетесь автором и обнаружите, что это изображение используется без вашего разрешения, сообщите нам о нарушении закона США «Об авторском праве в цифровую эпоху», пожалуйста, свяжитесь с нами Выберите разрешение и загрузите эти обои

    Загрузите эти обои как рабочий стол ПК и ноутбука (включая разрешения 720P, 1080P, 2K, 4K, для обычных ПК и ноутбуков HP, Lenovo, Dell, Asus, Acer):

    Загрузите эти обои как рабочий стол iMac:

    iMac 21.5-дюймовый дисплей со светодиодной подсветкой:

    1920×1080

    Загрузите эти обои как рабочий стол MacBook:

    MacBook Air 13 дюймов, MacBook Pro 15.4 «:

    Полный размер — 1440×900

    MacBook Pro с дисплеем Retina 13,3 дюйма, MacBook Air с дисплеем Retina 13 дюймов, MacBook Air 13,3 дюйма (2020, M1):

    2560×1600

    Загрузите эти обои как рабочий стол с двумя мониторами:

    Скачать эти обои как рабочий стол с тройным монитором:

    Скачать эти обои как рабочий стол для четырех мониторов:

    Загрузите эти обои как рабочий стол iPhone или экран блокировки:

    iPhone 2G, iPhone 3G, iPhone 3GS:

    320 x 480

    iPhone 4, iPhone 4s:

    640 x 960

    iPhone 5, iPhone 5s, iPhone 5c, iPhone SE:

    640×1136

    iPhone 6, iPhone 6s, iPhone 7, iPhone 8:

    750×1334

    iPhone 6 plus, iPhone 6s plus, iPhone 7 plus, iPhone 8 plus:

    1242×2208

    iPhone X, iPhone Xs, iPhone 11 Pro:

    1125×2436

    iPhone Xs Max, iPhone 11 Pro Max:

    1242×2688

    iPhone Xr, iPhone 11:

    828×1792

    iPhone 12 mini, iPhone 13 mini:

    1080×2340

    iPhone 12, iPhone 12 Pro, iPhone 13, iPhone 13 Pro:

    1170×2532

    iPhone 12 Pro Max, iPhone 13 Pro Max:

    1284×2778

    Загрузите эти обои в качестве рабочего стола телефона Android или экрана блокировки (для обычных телефонов Samsung, Huawei, Xiaomi, Redmi, Oppo, Realme, Oneplus, Vivo, Tecno Android):

    Загрузите эти обои как рабочий стол iPad или экран блокировки:

    iPad, iPad 2, iPad Mini:

    768×1024, 1024×768

    iPad 3, iPad 4, iPad Air, iPad Air 2, iPad 2017, iPad Mini 2, iPad Mini 3, iPad Mini 4, 9.IPad Pro, 7 дюймов:

    2048×1536, 1536×2048

    iPad Pro 10,5 дюйма:

    2224×1668, 1668×2224

    iPad Pro 11 дюймов:

    2388×1668, 1668×2388

    iPad Pro 12,9 дюйма:

    2732×2048, 2048×2732

    iPad Air 10,9 дюйма:

    2360×1640, 1640×2360

    iPad 10,2 дюйма:

    2160×1620, 1620×2160

    iPad mini, 8,3 дюйма:

    2266×1488, 1488×2266

    Загрузите эти обои в качестве рабочего стола или экрана блокировки планшетов Surface и Android:

    Похожие обои HD

    • 1920 г. Икс 1080 px

      Япония улица дома, киберпанк, дождь, огни, город, реклама
    • 1920 г. Икс 1080 px

      техника, дизайн, графика, информация, искусство, данные, интернет
    • 1920 г. Икс 1049 px

      Человек, стоящий на краю здания, иллюстрация, игровое приложение
    • 1920 г. Икс 1080 px

      техника, интернет, дизайн, бизнес, облако, данные, информация
    • 1920 г. Икс 1200 px

      астронавт сидит на лунных обоях, астронавт держит стеклянную бутылку с зеленой жидкостью, сидя на стуле в галактике
    • 1920 г. Икс 1080 px

      техника, дизайн, графика, интернет, бизнес, коллекция, данные
    • 6720 Икс 4480 px

      Всеобщее достояние человек сидит на здании, человек, смотрит вниз, ноги, ступня, таймс-сквер
    • 1600 Икс 900 px

      Зеленая яма гадюка селективная фокусировка фотография, змея, рептилии
    • 1920 г. Икс 1080 px

      цитаты, дизайн, графика, символ, значок, бизнес, черный, элемент
    • 1920 г. Икс 1200 px

      астронавт цифровые обои, Карлсберг, Луна, реклама
    • 1920 г. Икс 1200 px

      Реклама, космонавт, пиво, carlsberg, земля, луна, космос
    • 5419 Икс 3613 px

      Всеобщее достояние коллаж, постер, реклама, стена, дизайн, минимал, декор
    • 1920 г. Икс 1200 px

      Просто кока-кола, стеклянная бутылка кока-колы, напиток, реклама
    • 2560 Икс 1440 px

      Нью-Йорк, Timesquare, Нью-Йорк, Тайм-сквер, реклама
    • 1920 г. Икс 1080 px

      цитаты, знак, символ, значок, графика, дизайн, набор, интернет
    • 1920 г. Икс 1440 px

      еда, нож, помидоры, реклама, черный фон, студийный снимок
    • 1920 г. Икс 1080 px

      техника, дизайн, графика, бизнес, информация, концептуальное
    • 1920 г. Икс 1200 px

      Кэндис Свейнпол, модель, Духи, реклама, смотрит на зрителя
    • 1024 Икс 768 px

      Иллюстрация бутылки Absolut Raspberri, водка, реклама
    • 1920 г. Икс 1080 px

      Девушка, Огни, Ночь, Город, Неон, Реклама, Synthpop
    • 1920 г. Икс 1080 px

      улица, реклама, киберпанк, огни, город, дождь
    • 4800 Икс 2400 px

      люди, поезд, вокзал, Япония, реклама, Токио, персонажи
    • 1920 г. Икс 1080 px

      цитаты, дизайн, графика, элемент, бизнес, искусство, значок, символ
    • 1920 г. Икс 1080 px

      белый костюм космонавта, космос, пиво, луна, земля, реклама
    • 7360 Икс 4912 px

      Всеобщее достояние цифровой маркетинг, поисковая оптимизация, контент, реклама
    • 1920 г. Икс 1080 px

      техника, дизайн, интернет, бизнес, коллаж, данные, графика
    • 1920 г. Икс 1200 px

      Carlsberg Beer in Space, реклама, продвижение
    • 4213 Икс 2904 px

      Всеобщее достояние Плакат «Вкусная кока-кола снимает усталость», реклама
    • 1680 Икс 1050 px

      реклама, световая, копия пространства, осветительное оборудование
    • 4688 Икс 3516 px

      женские черные волосы, девушка, удивление, постер, реклама, часть человеческого тела
    • 1920 г. Икс 1080 px

      Юмор, Реклама, Бэнкси
    • 4608 Икс 3072 px

      Всеобщее достояние стикер с логотипом ассорти бомба, стена, цвет, бумажное украшение, разноцветный
    • 3253 Икс 3156 px

      Всеобщее достояние Лидл логотип, реклама, щит, рекламный знак, супермаркет
    • 3168 Икс 4752 px

      Всеобщее достояние включенная синяя разноцветная неоновая вывеска Coffee, фото
    • 1920 г. Икс 1200 px

      черно-белая куртка на молнии, реклама, минимализм, простой фон
    • 1920 г. Икс 1080 px

      Моника Беллуччи, реклама, портрет, цветы, реклама
    • 3008 Икс 2000 г. px

      Всеобщее достояние синий, желтый и белый неоновая вывеска Happy Hour, светодиодный индикатор, вывеска
    • 4224 Икс 2376 px

      Всеобщее достояние Доска объявлений Prada, реклама, реклама, наружная реклама
    • 1920 г. Икс 1080 px

      планета, пиво, Земля, космос, звезды, релаксация, алкоголь, Carlsberg
    • 5184 Икс 3456 px

      Всеобщее достояние Пивная бутылка Heineken, рекламная фотография, алкоголь, напиток
    • 1920 г. Икс 1080 px

      аннотация, дизайн, графика, символ, значок, элемент, интернет
    • 4000 Икс 3000 px

      Всеобщее достояние Женщина, стоящая возле уличного знака Шанель, грузовая марка, Монако, шоппинг
    • 1920 г. Икс 1200 px

      Teen Models, обувь, девушка, мода, реклама, пара
    • 4000 Икс 3000 px

      Всеобщее достояние белое бетонное здание с вывеской Chanel, грузовая марка, Монако
    • 4000 Икс 3000 px

      Всеобщее достояние Prada плакат, реклама, рекламный щит, рекламный знак
    • 5705 Икс 3793 px

      Всеобщее достояние Планета Голливуд неоновые вывески, реклама, световая, реклама
    • 1920 г. Икс 1200 px

      кубики льда, Джек Дэниэлс, алкоголь, банка, виски, напиток, напитки
    • 3357 Икс 2417 px

      Всеобщее достояние Фанта бидон на воду, бидоны, напитки, апельсиновый сок, брызги, реклама
    • 1920 г. Икс 1080 px

      цитаты, интернет, дизайн, коллекция, облако, данные, информация
    • 1366 Икс 768 px

      произведение искусства, автобусы, змея, реклама, коммерческий, транспорт
    Загрузка обоев

    Повторяющаяся эволюция нарушения регуляции циркадных часов в популяциях пещерных рыб

    Образец цитирования: Mack KL, Jaggard JB, Persons JL, Roback EY, Passow CN, Stanhope BA, et al.(2021) Повторяющаяся эволюция нарушения регуляции циркадных часов в популяциях пещерных рыб. PLoS Genet 17 (7): e1009642. https://doi.org/10.1371/journal.pgen.1009642

    Редактор: Джастин К. Фэй, Университет Рочестера, США

    Поступило: 30 сентября 2020 г .; Принята к печати: 3 июня 2021 г .; Опубликован: 12 июля 2021 г.

    Авторские права: © 2021 Mack et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Авторы подтверждают, что все данные, лежащие в основе результатов, полностью доступны без ограничений. Все данные о последовательностях были депонированы в архиве короткого чтения (SRA) под регистрационным номером PRJNA421208. Данные, лежащие в основе анализа РНК FISH, можно найти на http://www.stowers.org/research/publications/libpb-1485. Дополнительные соответствующие данные находятся в файлах вспомогательной информации.

    Финансирование: Финансирование было поддержано NIH (1R01GM127872-01 для SEM, ACK и NR, R21NS122166 для ACK и JEK (https: // www.nih.gov/) и NSF присуждает IOS 165674 ACK, NSF присуждает IOS 1933428 JEK, NR и SEM (https://www.nsf.gov/), награду BSF США и Израиля для ACK (https: // www .bsf.org.il /), NSF IOS-1933076, JK и SEM, и NSF EDGE 1923372, Erik Duboué, JK, и SEM. KLM был поддержан премией Национальной исследовательской службы Рут Киршштейн от NIH и постдокторской стипендией Стэнфордского центра вычислительной, эволюционной и геномики человека (CEHG). CNP был поддержан программой постдокторантуры Grand Challenges in Biology Колледжа биологических наук Университета Миннесоты.JBJ поддерживался NIH 5T32HL007713-28. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Циркадные ритмы, которые поддерживают 24-часовые колебания физиологии и поведения, почти повсеместны в природе [1,2]. Будучи адаптивным механизмом для организмов, чтобы предвидеть предсказуемые изменения в окружающей их среде [3,4], биологические часы координируют различные биологические процессы, от цикла сна и бодрствования и метаболизма у животных до роста и фотосинтеза у растений [5-7].У позвоночных циркадные ритмы регулируются петлями обратной связи транскрипции, где белки часов прямо или косвенно регулируют экспрессию генов, из которых они транскрибируются. Петли обратной связи циркадных часов приводят к колебаниям экспрессии генов на ~ 24 часа [8]. Эти осциллирующие транскрипты составляют циркадный транскриптом и являются важным источником ритмической физиологии и поведения [9–11]. Хотя биологические часы являются эндогенными, временные метки окружающей среды («zeitgebers»), включая свет, температуру и наличие пищи, синхронизируют часы с внешней средой организма (например,г., увлечение) [12–15]. Подвергание животных циклам свет-темнота, которые отличаются от 24-часового дня, оказывает глубокое влияние на здоровье организма, включая снижение продуктивности, учащение болезней и сокращение продолжительности жизни [16–18]. Однако, несмотря на детальное понимание нейронной и молекулярной основы циркадных ритмов, меньше известно о механизмах, лежащих в основе эволюции циркадных ритмов в ответ на изменение экологического давления.

    Когда виды приживаются в средах, которые изолированы от циклов день-ночь, биологические часы, по прогнозам, станут ненужными и в конечном итоге полностью исчезнут [19,20].Хотя это предсказание кажется интуитивным, глубокое эволюционное происхождение биологических часов и их роль в координации широкого разнообразия биологических процессов также предполагает сильное адаптивное ограничение [20]. Следовательно, системы, которые переместились в среду без цейтгеберов, такую ​​как пещеры, предоставляют уникальную возможность понять взаимосвязь между экологией видов, эволюцией биологических часов и процессами, регулируемыми часами ниже по течению [21–23]. В то время как в настоящее время имеются существенные доказательства существования подземных видов с измененными поведенческими или физиологическими ритмами по сравнению с поверхностными родственниками [20,21], лишь несколько исследований были сосредоточены на молекулярной природе циркадных часов в аритмической среде [22–24].Кроме того, до сих пор ни одно исследование не изучало общегеномные паттерны экспрессии или расхождения последовательностей, связанные с изменениями циркадных ритмов в какой-либо подземной системе.

    Мексиканская тетра, Astyanax mexicanus , существует в виде поверхностных популяций, обитающих в реках с устойчивыми световыми и температурными ритмами, и по крайней мере 30 пещерных популяций, которые живут в постоянной темноте с ограниченными колебаниями температуры или другими факторами окружающей среды [25]. Пещерные популяции A . mexicanus неоднократно развили набор черт в окружающей среде пещеры, включая дегенеративные глаза [26–28], снижение пигментации [29–32] и изменения в метаболизме и поведении [33–42]. В настоящее время также имеется множество доказательств того, что циркадные ритмы и поведение во сне существенно изменяются в популяциях пещерных рыб [24,34,43,44]. В то время как пещерные рыбы в значительной степени поддерживают локомоторные и физиологические ритмы в светлых и темных условиях, несколько популяций демонстрируют потерю этих ритмов в постоянной темноте [24,43–47].В соответствии с представлением о том, что колонизация пещер связана с молекулярными нарушениями циркадных ритмов, исследование экспрессии гена циркадных часов per1a показало, что в то время как этот ген циклируется в популяциях пещер в лабораторных условиях, транскрипционные колебания подавляются в темноте и темноте. условий и отсутствует у пещерных рыб, собранных в дикой природе [24]. Кроме того, было обнаружено, что изменения циркадных ритмов у пещерных рыб снижают скорость метаболизма в постоянной темноте, предполагая, что изменения в циркадной биологии могут быть полезными при определенных условиях окружающей среды [43].Действительно, пещерные рыбы, по-видимому, устойчивы ко многим аспектам метаболической дисрегуляции, включая диабетоподобный фенотип, ожирение и нарушение сна, все из которых связаны с циркадной дисрегуляцией у людей [34,40,48,49].

    В свете убедительных доказательств расхождения поведенческих и молекулярных ритмов между A . mexicanus поверхностных и пещерных популяций, существование нескольких пещерных популяций независимого происхождения обеспечивает уникально мощную сравнительную основу для изучения эволюции циркадных часов в этой системе.Повторное вторжение и установление A . mexicanus в пещерах позволяет нам не только задаться вопросом, как изменяется молекулярная основа циркадных ритмов в пещерных популяциях, но и предсказуемы ли изменения в биологическом измерении времени и могут ли они повторяться в разных популяциях. Здесь мы используем комбинацию РНК-секвенирования, популяционной геномики и флуоресценции РНК in situ гибридизации (FISH) и мутаций, индуцированных CRISPR / Cas9, чтобы охарактеризовать дивергенцию в циркадном транскриптоме и циркадной функции между тремя популяциями пещер и одной поверхностной популяцией.В целом, наши данные демонстрируют, что биологические часы, высококонсервативный механизм у большинства многоклеточных животных, неоднократно и независимо нарушались на молекулярном уровне в уникальном происхождении пещерных рыб. Уникальные нарушения циркадных ритмов у пещерных рыб различного происхождения обеспечивают мощную платформу для изучения взаимосвязи между естественными мутантами часового типа и циркадной биологией.

    Результаты

    Меньшее количество генов свидетельствует о ежедневном циклическом движении в популяциях пещерных рыб

    Чтобы идентифицировать изменения в ритмической экспрессии между пещерной и поверхностной популяциями, мы выполнили RNAseq с общей РНК от целых животных в трех пещерных популяциях (Молино, Пачон и Тинаха) и одной поверхностной популяции (Рио Чой), собираемой каждые 4 часа в течение одного дня. цикл в постоянной темноте через 30 дней после оплодотворения (dpf).Пачон и Тинаха — две популяции, представляющие то, что считается «старой» линией A . mexicanus и являются сестринскими таксонами, где Río Choy и Molino считаются «новыми» видами рыб и более тесно связаны друг с другом, чем популяции старых линий [50]. Рыб выращивали в цикле свет-темнота (14:10) для синхронизации поведенческих и молекулярных часов, а затем переводили в постоянную темноту за 24 часа до начала периода отбора проб. В среднем 14 197 772 считывания было отображено на образец (данные S1 и рисунки A-D в тексте S1), с 6 повторностями на популяцию, собранными в 6 временных точках (всего 144 образца).Фильтрация генов с низкой экспрессией (<100 общего количества во всех образцах) привела к 21 048 аннотированным генам, которые использовались для последующего анализа. Хотя пещерные популяции не монофилетичны [50], анализ основных компонентов показал, что основной осью дифференциации между образцами является среда обитания ( и . и ., Пещера или поверхность; рис. E в тексте S1).

    Мы использовали JTK_cycle, непараметрический алгоритм, который обнаруживает цикличность в наборах данных в масштабе генома, для обнаружения 24-часовых колебаний в количестве транскриптов [51].Мы обнаружили, что у поверхностной популяции было наибольшее количество ритмических транскриптов (539), за ней следовали Tinaja (327), Pachón (88) и Molino (83), соответственно (FDR <0,05, см. Таблицу A в тексте S1), что соответствует с представлением о том, что молекулярный цикл экспрессии генов снижается в популяциях пещерных рыб. На удивление мало генов (19) показали значительную цикличность среди всех пещерных и поверхностных популяций (рис. 1A и 1B). Гены с ритмической транскрипцией во всех четырех популяциях включают гены, которые играют известные роли в циркадном ритме (например,g., per1a , per1b , cipca , ciarta , dbpb ), предполагая, что некоторые компоненты основных часов остаются функциональными в популяциях пещерных рыб (см. данные S1). Во всех популяциях, кроме Молино, мы обнаружили значительное перекрытие между ритмическими транскриптами в A . mexicanus и идентифицированные у рыбок данио [52,53] (см. Методы; при p <0,05: поверхность, Pachón и Tinaja, все p <1 x 10 −4 ; Molino p = 1, гипергеометрические тесты).Ритмические транскрипты как в поверхностных, так и в пещерных популяциях были обогащены терминами GO, связанными с циркадным ритмом, включая «регуляцию циркадного ритма» (GO: 0042752) (поверхность, q = 4.85 x 10 −10 ; Tinaja, ). q = 4,16 x 10 −8 ; Pachón, q = 2,33 x 10 −6 ; Molino, q = 4,98 x 10 −6 ). Ритмические транскрипты в поверхностной популяции также были сильно обогащены для «визуального восприятия» (GO: 0007601) ( q = 4.80 x 10 −12 ), «сенсорное восприятие светового стимула» (GO: 0007602) ( q = 9,28 x 10 −12 ) и «фототрансдукция» (GO: 0007602) ( q = 1,14 x 10 −7 ), в отличие от пещерных популяций (списки обогащенных терминов в данных S1). Население пещеры Тиная показало удивительно большое количество уникально ритмичных транскриптов (267 транскриптов циклически меняются только в Тинахе). Эти транскрипты были обогащены терминами, относящимися к репликации ДНК (GO: 0006260) ( q = 9.55 x 10 −4 ), митотический клеточный цикл (GO: 0000278) ( q = 4,48 x10 -3 ) и восстановление ДНК (GO: 0006281) ( q = 0,012) (данные S1).

    Рис. 1.

    A. Перекрытие генов с ритмической экспрессией между популяциями. B. Тепловая карта генов с ритмическими паттернами у поверхностных рыб (Рио Чой), упорядоченная по фазе гена, по сравнению с экспрессией в пещерных популяциях. Каждый столбец представляет экспрессию гена в единичный момент времени, выборку которой производят каждые четыре часа в диапазоне от 0 до 20 часов.Красные прямоугольники соответствуют более высокому выражению. C. Идентификация генов с изменениями ритмичности между пещерным и поверхностным населением. Гены с более высокими значениями амплитуды имеют большие различия между пиком и впадиной экспрессии, где гены с большей периодичностью демонстрируют более сильные паттерны циклических колебаний (см. Методы). Гены окрашены в соответствии с их значениями S DR q . Гены с положительными значениями для обоих показывают повышенную ритмичность в популяции на поверхности, тогда как гены с отрицательными значениями показывают повышенную ритмичность в популяциях пещер.

    https://doi.org/10.1371/journal.pgen.1009642.g001

    Подчеркивая, что потеря ритмичности неоднократно развивалась среди независимых источников пещерного фенотипа, потеря ритмической экспрессии часто была специфичной для популяции. В то время как почти 22% (117) генов, которые оказались ритмичными в популяции на поверхности, были аритмичными (значение p- > 0,5) во всех трех популяциях пещер, 77% (416) генов были аритмичными как минимум в одной популяции пещер (Таблица A в S1 Text, S1 Data).И наоборот, ни один гены, которые были ритмичными во всех пещерах, не были аритмичными в популяции на поверхности, что позволяет предположить, что потеря ритмической экспрессии происходит из-за обитания в пещерной среде. Гены аритмии во всех популяциях пещер были обогащены категориями ГО, включая «сенсорное восприятие светового стимула» ( q = 1,48 x 10 -6 ) и «процесс нервной системы» ( q = 1,09 x 10 -5 ) (полный список терминов в S1 Data) и включают гены, участвующие в регуляции циркадного ритма (Таблица C в S1 Text).Напр., arntl2 кодирует активатор транскрипции, который формирует основной компонент циркадных часов и проявляет консервативную ритмическую активность у рыбок данио [52] и мышей [65]. Несмотря на проявление консервативной функции у позвоночных, arntl2 является аритмичным во всех трех популяциях пещер (поверхность, p = 0,0004, q = 0,02; все пещерные популяции, p > 0,5). Кроме того, мы обнаружили, что поверхностные транскрипты были значительно более ритмичными по своей экспрессии (например,g., имеют более низкие значения p- ), чем пещерные популяции (знаковый ранговый критерий Вилкоксона, p <0,002 во всех парных сравнениях пещеры и поверхности) при сравнении распределения значений JTK_cycle p- для ортологов с аннотированными ролями. в циркадном ритме (61 ген, см. «Методы», данные S1). Взятые вместе, эти результаты показывают потерю цикличности в различных генах основных часов в нескольких независимо полученных популяциях пещерных рыб.

    Пещерные и поверхностные популяции показывают различия в периодичности и амплитуде ритмических транскриптов

    Чтобы идентифицировать гены с изменениями ритмичности между пещерными и поверхностными популяциями, мы рассчитали дифференциальную оценку ритмичности ( S DR ) для каждого гена для каждой пары популяции пещеры и поверхности [66].Этот показатель учитывает как изменения ритмичности транскрипта, что определяется различиями в значении JTK_cycle p для каждого гена между поверхностными и пещерными популяциями, так и различия в устойчивости колебаний транскрипта, определяемые различиями. по амплитуде экспрессии генов между популяциями пещеры и поверхности. Мы обнаружили, что 103 гена показали большую ритмичность у поверхностных рыб для всех сравнений поверхностных и пещерных рыб (например, поверхностный-Pachón, поверхностный-Molino, поверхностный-Tinaja; данные S1) (рис. 1C).Этот набор генов был высокообогащен для пути «система циркадных часов» с 21-кратным обогащением по сравнению с фоновым набором генов, использованных в этом анализе ( q = 9,96 x 10 −11 ), и был только путь значительно обогатился после коррекции частоты ложных открытий. Однако многие изменения ритмичности, по-видимому, зависят от популяции пещеры: из 251 гена, для которого мы идентифицировали ритмические изменения между парой пещеры и поверхности, ~ 60% были идентифицированы только в одном или двух сравнениях популяций.Относительно небольшое количество генов показало значительно улучшенную ритмичность в отдельных пещерных популяциях по сравнению с поверхностными рыбами (рис. 1C, гены ниже нуля для дифференциальной периодичности и дифференциальной амплитуды z-балла), и ни один из генов не показал увеличения ритмичности в нескольких пещерных популяциях.

    Гены с ослабленной ритмической экспрессией в пещерных популяциях включают несколько основных и дополнительных компонентов основных часов транскрипции (Рис. 2A) (Таблица 1). В первичной петле обратной связи циркадных часов члены семейства (bHLH) -PAS (e.g., CLOCK, ARNTL) гетеродимеризуются и связываются с элементами ответа ДНК E-бокса, чтобы транскрипционно активировать ключевые белки часов (например, PER, CRY). Затем отрицательная обратная связь предоставляется гетеродимерами CRY: PER, которые ингибируют комплекс CLOCK: ARNTL. Другая регуляторная петля индуцируется комплексом CLOCK: ARNTL, активирующим транскрипцию генов nr1d1 и rorc (например, rorca и rorcb ), которые, в свою очередь, как положительно, так и отрицательно регулируют транскрипцию arntl ( см. рис. 2В).Многие из генов, которые транскрибируют эти активаторы и репрессоры, демонстрируют снижение или потерю цикличности в одной или нескольких популяциях пещер, а некоторые показывают снижение ритмичности во всех трех пещерах (например, rorca , rorcb , arntl2 ) ( Таблица 1 и Рис 2). В то время как снижение ритмичности генов основных часов поддерживает общее ослабление основного циркадного механизма в популяциях пещер по сравнению с поверхностными формами, несколько генов основных часов демонстрируют ослабление или потерю ритмической экспрессии только в одной популяции пещер (Рис. 2).

    Рис. 2.

    A. Ключевые циркадные гены с изменениями ритмичности в пещерных популяциях (см. Рис. U в тексте S1 для всех основных циркадных генов с изменениями ритмичности). Цветные линии представляют собой лессовую регрессию экспрессии генов во времени для каждой популяции. B. Упрощенная схема циркадных петель обратной связи, основанная на предполагаемых взаимодействиях у рыбок данио [9,55]. Серые прямоугольники указывают на гены, которые либо аритмичны, либо демонстрируют значительно сниженную ритмичность между пещерой и поверхностью.Гены, заключенные в белую рамку, не обнаруживают существенных различий между пещерой и поверхностью. Жёлтым цветом выделен основной цикл. Ярко-желтые круги представляют собой регулирующие белковые комплексы. Красные линии указывают на отрицательное регулирование, черные линии — на положительное регулирование. Примечательно, что cry4 не репрессирует активацию Clock / Bmal у рыбок данио и может выполнять функцию фоторецепторов [9,55]. Гены, которые не заключены в рамку, не показали свидетельств ритмической экспрессии ни в одной пещерной или поверхностной популяции. Пунктирные линии предназначены для наглядности.Гены без аннотированного ортолога у пещерных рыб не были включены в схему.

    https://doi.org/10.1371/journal.pgen.1009642.g002

    Гены со сниженной ритмичностью в популяциях пещерных рыб также включают гены, участвующие в регуляции колебаний физиологических и поведенческих ритмов (Таблица 1), а также невизуальные или дополнительные. -глазные опсины (например, exorh , parapinopsinb , opn6b ). Среди генов со снижением ритмичности во всех трех популяциях пещер находится арилалкиламино-N-ацетилтрансфераза 2 ( aanat2 ), ключевой регулятор синтеза мелатонина в шишковидной железе [62,67,68].Мутанты рыбок данио aanat2 меньше спят по ночам, что указывает на критическую роль в циркадной регуляции сна [62]. Как и у рыбок данио [62,67], экспрессия aanat2 на поверхности A . mexicanus демонстрирует устойчивое ритмическое поведение ( q = 6,6 x 10 −4 ) с пиком экспрессии в течение субъективной ночи. Напротив, пещерные рыбы не демонстрируют свидетельств ритмической транскрипции aanat2 (Молино, p = 1.0; Tinaja, p = 0.82; Pachón, p = 0,33), и экспрессия не увеличивается в этих популяциях в течение субъективной ночи (рис. 2). Другой ген, который демонстрирует снижение ритмичности во всех трех пещерах, — это camk1gb , который участвует в связывании основных часов пинеальной железы с физиологией эпифиза ниже по течению. Нокауты этого гена у рыбок данио значительно нарушают циркадную активность [63], подобно тому, что наблюдается у пещерных рыб Pachón [45,46]. Camk1gb также играет роль в регуляции ритмической транскрипции aanat2 ; нокдауны camk1gb уменьшают амплитуду ритма экспрессии aanat2 наполовину у рыбок данио, но не влияют на транскрипцию основных часов [63].Эти находки предполагают, что изменения в регуляции транскрипции генов ниже основных часов потенциально влияют на потерю ритмического поведения у пещерных рыб.

    Ритмические транскрипты в популяциях пещер показывают задержку фазы по сравнению с популяциями на поверхности

    Время транскрипционных колебаний является ключом к согласованию циркадных ритмов и циклов окружающей среды. Чтобы определить, изменилась ли скорость езды на велосипеде на A . mexicanus популяций, мы исследовали, различается ли время циркадных часов между пещерными и поверхностными популяциями, сравнивая фазы циклических транскриптов между популяциями.

    В соответствии с бимодальным распределением циркадных фаз, наблюдаемым в других системах [52,69], большинство транскриптов в поверхностных и пещерных популяциях A . mexicanus демонстрируют пик экспрессии перед субъективным рассветом или закатом (см. Фиг. 3A). Однако это распределение было смещено в сторону более позднего субъективного дня у рыб из всех трех пещерных популяций по сравнению с популяциями на поверхности. Этот сдвиг во всем транскриптоме согласуется с анализом отдельных генов Beale et al .[24], которые показали, что гены часов per1 и cry1a отображают задержки фазы у рыб из пещер Пачон и Чика относительно поверхностных рыб (Рис. F в тексте S1) (см. Также [70]).

    Рис. 3.

    A. Распределение времени пика экспрессии ритмических транскриптов в каждой популяции. Полоски указывают на субъективный день и ночь. B. Циклические гены в среднем показывают задержку фазы в популяциях пещер по сравнению с их фазой в популяции на поверхности.

    https: // doi.org / 10.1371 / journal.pgen.1009642.g003

    Затем мы сравнили фазу A . mexicanus с оценками фаз ортологичных генов тактовых импульсов у рыбок данио, отобранных в темноте [52]. Пока данио и . mexicanus расходились на 146 MYA [71], время пика экспрессии генов тактовых импульсов было очень сходным у рыбок данио и поверхностных рыб (средняя разница 0,8 часа между ортологами, таблица D в тексте S1). Для сравнения, фаза часовых генов в основной и вспомогательной петлях часто более сдвинута в пещерных популяциях относительно фазы данио рерио, чем в поверхностной популяции (медианные сдвиги 4.7, 2,2 и 3,5 часа для Tinaja, Molino и Pachón соответственно) (Таблица D в тексте S1). Таким образом, фаза основных часов и дополнительных петель, по-видимому, хорошо сохраняется в течение длительного периода эволюции между рыбками данио и поверхностным Astyanax , но, по-видимому, резко смещается в пещерных популяциях.

    Чтобы дополнительно охарактеризовать различия в фазах между поверхностными и пещерными популяциями, мы сравнили фазы всех генов, включая гены в стержневых и дополнительных петлях сверху, с доказательствами ритмической экспрессии в парах популяции пещеры и поверхности (где p <0.05 для гена на поверхности и сравниваемого населения пещеры). В соответствии с фазовыми сдвигами, наблюдаемыми для генов в основных часах и дополнительных петлях, для каждого сравнения поверхности пещеры мы обнаружили, что ритмические транскрипты показали значительно более поздний пик экспрессии в популяциях пещер (знаковый ранговый критерий Вилкоксона, все парные сравнения p < 2,2 x 10 −16 ; средний сдвиг, поверхностный-Пачон: 2,03 часа, поверхностный-Тинаха: 1,3 часа, поверхностный-Молино: 0,48 часа; таблица E в тексте S1) (рис. 3B, фазы всех генов в данных S1).

    Гены с циркадными

    цис-элементами демонстрируют потерю цикличности, несмотря на сохранение мотивов в пещерных популяциях

    Поскольку цис- регуляторных элементов часто управляют различиями экспрессии, мы исследовали, проявляют ли эти критические регуляторы нарушения, как в циркадном транскриптоме. У позвоночных циркадные колебания в экспрессии генов являются следствием взаимосвязанных петель транскрипционной обратной связи белков основных часов, связывающихся с комбинацией известных цис- элементов (E-box, RRE, D-box) в промоторах и энхансерах генов-мишеней. [52,72].Элементы E- и D-box также играют критическую роль в светозависимой активации часов [73,74]. Время связывания активатора и репрессора с циркадными цис- элементами приводит к фазе осциллирующих транскриптов [72].

    Чтобы понять, сохраняются ли вероятные функции ключевых циркадных регуляторных мотивов между поверхностью A . mexicanus и рыбок данио мы извлекли промоторные последовательности всех генов с ритмической транскрипцией в поверхностной популяции и идентифицировали мотивы связывания фактора транскрипции (TF) в каждой последовательности (таблица F в тексте S1).Мы рассматриваем ритмические гены со значительными циркадными мотивами связывания (то есть последовательностями E-box, RRE, D-box) предполагаемыми мишенями для часовых белков в петле циркадной обратной связи. Затем мы использовали метод скользящего окна, чтобы определить конкретное временное окно, когда фазы циркадных целей TF наиболее обогащены у поверхностной рыбы. В соответствии с наблюдениями на рыбках данио [52], мотивы E-box, которые связаны комплексами CLOCK-ARNTL как часть основной петли обратной связи [75], были обогащены промоторами генов с пиком экспрессии утром (CT 2 ), где элементы RRE, которые связаны белками RORA и NR1D1 / NR1D2 вспомогательной петли [76], были обогащены промоторами генов с пиком экспрессии вечером (CT 14–16) (рис. G в тексте S1) (см. Методы).D-box, который связывает факторы bZip, включая NFIL3, также был обогащен промоторами генов с пиком экспрессии утром (CT 0-6), как у рыбок данио [52] (рис. H в тексте S1). Таким образом, наш анализ предполагает, что ключевые циркадные регуляторные мотивы и, следовательно, время ключевых регуляторных каскадов, обеспечивающих циркадные колебания в экспрессии генов, в значительной степени сохраняются между A . mexicanus поверхностная рыба и данио.

    Затем, чтобы понять, может ли дивергенция в cis- регуляторных элементах вносить вклад в нарушение регуляции экспрессии циркадных генов у пещерных рыб, мы сравнили промоторные последовательности пещерных и поверхностных рыб.Во-первых, мы провели поиск циркадных цис- элементов в последовательностях пещерных рыб перед генами, утратившими ритмичность в пещерных популяциях. Большая часть предполагаемых мишеней основных тактовых элементов, идентифицированных у поверхностных рыб (например, ритмические гены, идентифицированные как имеющие мотивы E-box, RRE или D-box в их промоторной последовательности, как описано выше), не циклически повторяются в одном или нескольких популяции пещер:> 77% имеют аритмию по крайней мере в одной популяции пещер. Мы проверили, можно ли объяснить потерю циркадной транскрипции сокращением циркадных мотивов, однако мы не нашли доказательств обогащения связывающих мотивов в промоторных последовательностях этих предковых ритмических генов у поверхностных рыб по сравнению с популяциями пещер ( p. = 1 для всех протестированных мотивов, см. Текст S1).Кроме того, почти для всех генов, для которых мы идентифицировали проксимальный циркадный мотив у поверхностных рыб, мы также идентифицировали сайт связывания у пещерных рыб (но см. Текст Таблицы G S1 для случаев потери мотива). В целом, наш анализ показал, что (1) не было различий в обогащении сайтов связывания между пещерными и поверхностными промоторными последовательностями в предковых ритмических генах, и (2) было несколько случаев, когда предполагаемые регуляторные последовательности цис- были идентифицированы в поверхностная рыба была нарушена в пещерных популяциях.Следовательно, наши данные подтверждают, что уменьшение количества ритмических транскриптов у пещерных рыб может быть следствием изменений транскрипции основных тактовых генов или пути ввода света, а не дивергенции в целевых сайтах связывания цис--мишени нижележащих генов ( например, транс- эффектов или цис на транс эффектов).

    Генетическая дифференциация часовых генов между пещерной и поверхностной популяциями

    Охарактеризовав широко распространенную дисрегуляцию транскрипции циркадного транскриптома у пещерных рыб, мы искали доказательства исключительных различий частоты аллелей между пещерными и поверхностными популяциями среди циркадных генов.Геномные показатели популяции были рассчитаны для трех пещерных популяций: Молино (n = 9), Пачон (n = 10), Tinaja (n = 10), поверхностной популяции Рио-Чой (n = 9) и одной дополнительной поверхностной популяции (Rascón , n = 8), по которым имеются геномные данные популяций. Мы обнаружили, что из 416 генов, которые показали пониженную ритмичность экспрессии по крайней мере в одной пещерной популяции, 77 были в 5% наибольших значений F ST по всем генам в геноме по крайней мере для одного сравнения поверхности пещеры. .Эти выбросы включали гены с известной ролью в регуляции циркадных ритмов (например, cry1ba , exorh ) (данные S1).

    Если циркадные ритмы не нужны в пещерной среде, мы можем наблюдать ослабление очищающего отбора в кодирующих белки последовательностях генов часов. Напротив, гены часов также могут быть важными регуляторами других процессов (например, [77,78]), и поэтому кодирующие последовательности могут оставаться под сильным очищающим отбором вследствие плейотропии.Чтобы выяснить роль расслабленного отбора в эволюции часов, мы выровняли пещеру и поверхность . mexicanus последовательности из 18 генов из основной и дополнительной петли, а также aanat2 и exorh с однозначными ортологами до 23 видов костистых тел (см. Данные S1 и рис. W в тексте S1). Выровненные кодирующие последовательности использовали для проверки изменений в интенсивности отбора в клонах, ведущих к популяциям пещерных рыб (Molino и Pachón / Tinaja) в рамках филогенетической структуры путем сравнения ω (отношения несинонимичных (dN) к синонимичным (dS) нуклеотидных замен) и отбора параметр прочности k с помощью моделей случайных эффектов в филиалах [79] (S1 Text).В часах ядра мы нашли per1b ( p = 0,0004), cry4 ( p = 0,0002), arntl2 ( p = 0,025) и cry1ab ( p = 0,048). ) демонстрируют свидетельства ослабления принуждения в Тинахе и Пачоне. Exorh , невизуальный опсин, также находился под ослабленным ограничением у Tinaja и Pachón ( p = 0,00015). Мы не нашли доказательств ослабления ограничений в тактовых последовательностях Молино. Сравнивая это с 1000 случайными перестановками 18 случайно выбранных ортологов, мы обнаружили, что количество генов часов с доказательствами ослабления ограничений у Пачона и Молино больше, чем ожидалось при случайной выборке ( p = 0.021).

    Среди регуляторов циркадного ритма с доказательствами ослабленного отбора мы идентифицировали варианты, которые, по расчетам, были предсказаны как вредные для функции белка. Мы идентифицировали варианты с высокой частотой (> = 0,8) в одной или нескольких популяциях пещер, но отсутствовали в поверхностных популяциях, а затем использовали алгоритмы прогнозирования in silico SIFT и VEP для оценки их потенциального воздействия на функцию белка (см. Данные S2 и данные S3. полный список прогнозов). Cry4 , как было обнаружено, несут вредную несинонимичную замену (Chr22: 17502170 N> Y) и предсказанный сдвиг рамки считывания (Chr22: 17504874–17504875) в Пачоне и Тинахе. Per1b , как было обнаружено, содержит два высокочастотных вредных варианта у Tinaja (Chr16: 34045043 R> W; Chr16: 34055448 P> R). Наконец, exorh содержал предсказанные вредные замены в Tinaja и Pachón (Пачон: Chr6: 45608103 L> I, Chr6: 45608179 A> V; Tinaja: Chr6: 45608103 L> I).

    Визуализация ключевых циркадных мРНК выявляет тканеспецифические паттерны экспрессии в пещерах и на поверхности

    Наши данные RNAseq предполагают, что ритмы в основных часах не регулируются, и что ритмические транскрипты сдвинуты по фазе в популяциях пещерных рыб.Циркадные системы костистых мышц сильно децентрализованы, и автономная экспрессия генов основных часов может наблюдаться во многих тканях. Следовательно, мы проверили, проявляется ли циркадная дисрегуляция по-разному в разных типах тканей в пещерных популяциях. Чтобы охарактеризовать временную экспрессию часовых генов в различных тканях в пещерной и поверхностной формах, мы использовали RNAscope fluorescence in situ hybridization (FISH) [80]. Мы собрали мозг и печень отдельных мальков 30dpf в трех временных точках (CT0, CT8 и CT16) [81] и выполнили RNA FISH для ключевых циркадных мРНК в первичной петле ( per1 и arntl1a ) и регуляторной петле ( rorca и rorcb ) (подробные сведения и элементы управления см. В разделе «Методы») (рис. IQ в тексте S1).

    Мы обнаружили, что временные паттерны экспрессии мРНК per1a и arntl1a в среднем мозге поверхностных рыб согласуются с нашими результатами RNAseq и паттернами экспрессии у рыбок данио [52] (Рис. 4B и Рис. N и O в S1 Text). Экспрессия Per1a сильно достигает пика на рассвете (CT0) и arntl1a циклов в противофазе и показывает высокую экспрессию в сумерках (CT16). Также в соответствии с нашими наблюдениями за целыми мальками, мы видим ряд популяционно-специфических изменений в экспрессии этих генов в пещерных популяциях.В пещерных популяциях per1a демонстрирует более широкое временное выражение и сохраняется в течение дня (рис. F и N в тексте S1). Arntl1a , как было обнаружено, экспрессируется более широко в Tinaja и Molino за пределами CT16, основного окна экспрессии в поверхностных популяциях. Средний мозг Molino также обнаруживает высокие базальные уровни экспрессии по сравнению с поверхностью, особенно на CT8, когда экспрессия per1a и arntla почти отсутствует у поверхностных рыб (Рис. 5 и Рис. L в тексте S1).

    Характер временной экспрессии per1a и arntl1a в поверхностной печени рыб аналогичен таковому в головном мозге. Напротив, пиковая и минимальная экспрессия в печени Pachón и Tinaja, по-видимому, не синхронизирована с экспрессией в среднем мозге (рис. 4A, «L» против «B»). Per1a Экспрессия в печени Tinaja максимальна на CT8, но наиболее высока в мозге на CT16. В среднем мозге Pachón экспрессия per1a и является самой высокой на CT0, но экспрессия наиболее высока в печени на CT8 и CT16.

    Рис. 4.

    Паттерны временной экспрессии (A) per1a (голубой) и arntl1a (пурпурный) и (B) rorca (голубой) и rorcb (пурпурный) в ткани мозга и печени в Astyanax mexicanus — популяций. Окрашивание in-situ с использованием РНКскопа в среднем мозге («B», верхние панели для каждой временной точки) и печени («L», нижние панели для каждой временной точки) поверхностных рыб и пещерных рыб (Pachón, Tinaja, Molino) в CT0, CT8, и CT16. Каждая временная точка представляет собой одну пробу рыбы с зондами, разделенными на два канала.Изображения представляют собой репрезентативные срезы двух рыб, собранных в определенный момент времени для каждой популяции. Масштабная шкала составляет 25 мкм.

    https://doi.org/10.1371/journal.pgen.1009642.g004

    Затем мы исследовали время экспрессии rorca и rorcb , двух членов регуляторной петли, которые регулируют экспрессию паралогов arntl и циркадная транскрипция [76]. Наши результаты RNAseq показывают, что rorca и rorcb демонстрируют пик экспрессии в полдень и минимальную экспрессию на CT0 или CT16 у цельной молоди у поверхностных рыб (рис. 2), аналогично тому, что наблюдалось у рыбок данио (таблица D в тексте S1).В соответствии с этим, РНК-FISH среднего мозга поверхностных рыб показал, что экспрессия rorca и rorcb была выше в полдень в среднем между повторениями (рис. 5C и рис. M, P и Q в тексте S1). По сравнению с поверхностными тканями, экспрессия rorca и rorcb в мозге и печени Tinaja и Pachón достигла пика позже (CT16). Молино, напротив, показал более высокую экспрессию в вечернее время для печени и в полдень для мозга для rorca и rorcb , хотя экспрессия сильно варьировала между повторностями (рис. 5C vs.5D). Опять же, Молино также показал высокую базальную экспрессию в среднем мозге по сравнению с другими популяциями.

    Рис. 5. Количественная оценка РНК FISH.

    А-Д. Экспрессия per1a , arntl1a , rorca и rorcb в мозге (A, C) и печени (B, D) в CT0, CT8 и CT16 в популяциях поверхностных рыб и пещерных рыб. Интенсивность канала зонда РНКскопа была нормализована к интенсивности канала DAPI в областях интереса идентичного размера, анатомически подобранных, чтобы обеспечить оценку экспрессии мРНК на клетку (см. «Методы» для получения полной информации о RNA FISH-анализе).Биологические реплики показаны в виде цветных точек на графике и представляют собой образец мозга или печени, взятый у одного человека. Столбцы отражают среднее значение, а столбцы ошибок показывают SEM биологических повторов. Статистические данные рассчитывались для каждого мРНК-зонда путем сравнения среднего значения каждой пещерной популяции с контрольным средним значением (поверхность) в определенные моменты времени с использованием обычного двухфакторного дисперсионного анализа. Тест Даннета использовался для исправления множественных сравнений между популяциями и временными точками. Скорректированные значения p <0,05 отмечены знаком * с использованием следующей схемы: 0.0332 (*), 0,0021 (**), 0,0002 (***) и <0,0001 (****).

    https://doi.org/10.1371/journal.pgen.1009642.g005

    Таким образом, как наблюдается в анализе RNAseq всего организма, тканеспецифическая экспрессия этих генов первичной петли и регуляторной петли подтверждает фазовые сдвиги и нарушение регуляции у пещерных рыб. транскриптов по сравнению с поверхностными рыбами, хотя наш анализ RNA FISH предполагает, что нарушения временной регуляции экспрессии per1a и arntl1a проявляются по-разному в тканях у пещерных рыб Pachón, Tinaja и Molino (Рис. 4).

    Ритмы мелатонина различаются у пещерных и поверхностных рыб

    Мелатонин — ключевой гормон и регулятор поведения в циркадной системе позвоночных. У большинства рыб суточные колебания мелатонина частично регулируются aanat2 : повышенные уровни экспрессии мРНК aanat2 во второй половине дня приводят к высоким уровням белка AANAT2 в ночное время и увеличению синтеза мелатонина [62,82]. Поскольку aanat2 не показывает ритмическую транскрипцию или увеличение в течение субъективной ночи в популяциях пещерных рыб (рис. 2), мы проверили, различаются ли ритмы мелатонина между пещерной и поверхностной популяциями.

    Чтобы определить, различаются ли ритмы мелатонина у пещерных и поверхностных рыб, уровни мелатонина были измерены у поверхностных и пещерных рыб в условиях светло-темноты и темноты-темноты утром (ZT 6) и вечером (ZT 18). В условиях свет-темнота, мелатонин увеличивался ночью у поверхностных рыб (двухфакторный дисперсионный анализ, p = 0,0002), Pachón ( p <0,0001) и Молино ( p = 0,012). Мы не обнаружили значительной разницы между вечерним и утренним уровнями мелатонина для Tinaja (рис. 6А).Напротив, в темноте и темноте уровень мелатонина повышался ночью у поверхностных рыб ( p = 0,0004), но не в какой-либо из популяций пещерных рыб (рис. 6B), что согласуется с отсутствием ритмичности экспрессии мРНК aanat2 в этих рыбах. населения. Следовательно, наши результаты показывают, что в то время как пещерные рыбы Пачон и Молино могут продуцировать ритмы мелатонина в светлых и темных условиях, эндогенные ритмы мелатонина теряются в постоянной темноте. Напротив, пещерные рыбы Tinaja, по-видимому, полностью утратили ритмы мелатонина, что указывает на функциональные различия в потере циркадной функции в популяциях пещерных рыб.

    Рис. 6.

    A. Мелатонин в условиях света-темноты. Десять личинок рыб были объединены вместе, гомогенизированы и извлечен мелатонин для каждой точки данных. Ночью уровень мелатонина повышался в популяциях поверхностных рыб, пачонов и молино (двухфакторный дисперсионный анализ). Существенных изменений в пещерной рыбе Tinaja не произошло. *, p = 0,0117; *** p = 0,0002; **** п <0,0001. Б. Мелатонин в темноте-темноте. Десять личинок рыб объединяли, гомогенизировали и экстрагировали мелатонин для каждой точки данных.Уровень мелатонина повышался ночью в популяции поверхностных рыб (двухфакторный анализ ANOVA). Не было значительных изменений в пещерных рыбах Тинаха, Пачон или Молино. *** p -значение = 0,0004.

    https://doi.org/10.1371/journal.pgen.1009642.g006

    aanat2 и rorca регулируют сон у поверхностных рыб

    Циркадные ритмы влияют на множество физиологических и поведенческих черт, включая регуляцию цикла сна и бодрствования [81].Наш анализ показывает, что гены основных часов и регулятор мелатонина , aanat2 не регулируются на уровне транскрипции, и что цикл мелатонина нарушается в темноте в пещерных популяциях. Aanat2 транскрипция и синтез мелатонина и необходимы для циркадной регуляции сна [62], что повышает вероятность того, что возникшие различия в циркадной транскрипции лежат в основе потери сна у пещерных рыб [34]. Следовательно, мы стремились проверить роль aanat2 во времени двигательной активности и сна.

    Чтобы понять роль aanat2 в регуляции активности покоя в A . mexicanus , мы сгенерировали мозаику поверхностных рыб для мутаций в aanat2 (хрустящие корочки) с использованием CRISPR / Cas9 (см. Методы). Рыбы Crispant 30 dpf и контрольные братья и сестры дикого типа (WT) были фенотипированы на сон и двигательную активность, как описано ранее [44,83]. Продолжительность ночного сна (минут / час) была значительно сокращена у aanat2 чипсов (Mann-Whitney U, p = 0.015), но хрустящие корочки и рыба WT спали одинаковое количество за 24-часовой период (рис. 7B и 7C). В свете сниженной экспрессии RNAseq aanat2 в течение субъективной ночи во всех популяциях пещерных рыб, наши четкие результаты предполагают, что различия в экспрессии aanat2 могут вносить вклад в снижение ночного сна, наблюдаемого у пещерных рыб.

    Рис. 7. Рыбы-мутанты aanat2 и rorca обнаруживают роль этих генов в поведении сна в A . Мексика .

    A. Общий сон существенно не изменился между контрольной и aanat2 хрустящей поверхностной рыбой (Mann-Whitney U, p = 0,99). ДО Н.Э. Дневной сон существенно не меняется между WT и хрустящей рыбой aanat2 (Mann-Whitney U, p = 0,22). Ночной сон значительно снижен у анат2 хрустящих коров по сравнению с контрольной группой дикого типа (Mann-Whitney U, p = 0,015). D. Общий сон значительно снижен у хрустящих рыб rorca по сравнению с контрольными животными дикого типа (Mann-Whitney U, p <0.0001). E-F. Дневной сон не был значительно сокращен между WT и rorca crispants (непарный t-тест, p = 0,56). Ночной сон значительно снижен у rorca crispants по сравнению с контрольной группой WT (Mann-Whitney U, p <0,0001).

    https://doi.org/10.1371/journal.pgen.1009642.g007

    Транскрипция генов основных часов также была нарушена в популяциях пещерных рыб, при этом некоторые гены основных часов (например, rorca ) показали снижение или потерю ритмических экспрессия во всех трех пещерных популяциях.Чтобы изучить функциональные последствия повторяющейся эволюции нарушения одного из таких генов, мы создали хрустящие корочки для rorca . Было обнаружено, что хрустящие корочки Rorca спят значительно меньше минут в час ночью по сравнению с родственными рыбами WT (Mann-Whitney U, p <0,0001, рис. 7E и 7F). Кроме того, rorca crispants также спят меньше в целом в течение 24-часового периода (Mann-Whitney U, p <0,0001, рис. 7D). В то время как поверхностные рыбы WT спят в среднем 5 человек.16 часов в сутки, поверхностные хрустящие корочки rorca спят всего 2,26 часа в сутки. Следовательно, неоднократно развивающаяся дисрегуляция транскрипции, наблюдаемая в основных часах в популяциях пещерных рыб, может также вносить вклад в эволюцию потери сна, наблюдаемую в популяциях пещерных рыб.

    Обсуждение

    Циркадные ритмы почти повсеместны у эукариот, управляя аспектами поведения, физиологии и метаболизма [2]. Считается, что биологические часы обеспечивают организмам механизм для синхронизации своей физиологии и поведения с предсказуемыми суточными циклами [3,4].Однако у нас есть ограниченное понимание того, как биологические часы изменяются в условиях аритмической среды, где организмы изолированы от обычных сигналов окружающей среды, и как это влияет на физиологию и поведение ниже по течению [8,21,24,84,85]. Здесь мы демонстрируем репликацию, независимое происхождение пещерного фенотипа A . mexicanu s предоставляют беспрецедентную возможность изучить, как часы нерегулируются в аритмической среде. Мы выявили множество повторяющихся особенностей циркадной дисрегуляции в разных популяциях (например,g., потеря колебаний транскриптов в основных часах, сдвиги в циркадных фазах), а также нарушение регуляции циркадных часов в высшей степени специфично для популяции.

    Нарушение регуляции часов и ослабленный отбор часовых генов поддержали в значительной степени независимую потерю молекулярной основы для циркадных ритмов среди различных пещер. Например, пещерные популяции Молино и Пачон показали менее 1/3 циклических транскриптов у пещерной рыбы Tinaja. Наш анализ РНК FISH также показал популяционно-специфическое разделение ритмов для генов в основной петле ( arntl1a , per1a ) в пещерных популяциях по сравнению с поверхностными рыбами в различных тканях.У рыб большинство тканей и клеток имеют независимые, чувствительные к свету кардиостимуляторы [14,86], и предыдущая работа была посвящена A . mexicanus отобранные клипсы для плавников [24]. Тканевая специфичность может способствовать паттернам дисрегуляции определенных циркадных генов, исследованных в нашем наборе данных RNAseq. Хотя эти специфические для популяции особенности могут быть стохастическими, на эволюцию часов в различных пещерах также могут влиять невизуальные zeitgebers, специфичные для пещер, такие как присутствие пищи или других ритмичных животных [22].В настоящее время нет доказательств, подтверждающих активность летучих мышей, особенно в качестве zeitgebers для пещерных рыб [24], хотя будущая работа, сосредоточенная на экологических сигналах в конкретных пещерах, может пролить свет на то, какие факторы окружающей среды влияют на эволюцию циркадных часов в этой системе.

    Изменения в фазе циркадных генов между популяциями поверхностных и пещерных рыб предполагают различия в увлечении между популяциями. Одним из потенциальных механизмов фазовой задержки является дивергенция в пути поступления света, потенциальными кандидатами на которые являются циркадные невизуальные и экстраокулярные опсины [70].Ритмическая экспрессия была потеряна или значительно снижена для некоторых опсинов, включая экстраокулярный опсин , экзо-родопсин ( exorh ). У рыбок данио этот ген играет важную роль в опосредовании эффектов света окружающей среды на ритмы пинеальной железы и синтез мелатонина посредством регуляции aanat2 . Истощение Exorh приводит к значительному снижению транскрипции aanat2 , предполагая, что он может быть ответственным за инициацию транскрипции aanat2 в ответ на условия освещения [87].Последовательности Exorh были сильно дифференцированы, с доказательствами ослабленного отбора, между популяциями пещер Пачон и Тинаха и поверхностными популяциями. Невизуальные мутанты opsin, как было обнаружено, играют важную роль в обеспечении пути ввода света периферическими часами у сомалийских слепых пещерных рыб [22], делая мутации в невизуальных опсинах интересными кандидатами на изменения в регуляции часов у пещерных рыб Astyanax .

    Важный открытый вопрос заключается в том, как нарушение регуляции циркадного транскриптома повлияло на последующие фенотипы пещерных рыб и какие последствия эти изменения имеют для приспособленности организма.Популяции пещерных и поверхностных рыб демонстрируют различия в двигательных и метаболических ритмах в постоянной темноте [24,43]. Мы предполагаем, что нарушение регуляции циркадных часов также играет роль в эволюции потери сна у пещерных популяций [34]. Хотя биологические часы играют важную роль в регулировании цикла сна и бодрствования, эволюция часов никогда не была связана с эволюционировавшими различиями сна между популяциями или видами. В дополнение к повторяющимся изменениям в популяциях пещер в ядре и дополнительных петлях (напр.g., rorca , rorcb , arntl2 ), мы также обнаружили, что aanat2 , регулятор синтеза мелатонина в шишковидной железе, показал снижение ритмичности во всех трех популяциях пещер. Cavefish не обнаруживал повышенной экспрессии aanat2 в течение субъективной ночи (Рис. 2), в отличие от поверхностных рыб и других костистых рыб [82]. Повышение уровня мРНК aanat2 в ночное время связано с повышением уровня мелатонина и наступлением ночного сна [62].Кроме того, было обнаружено, что уровни мелатонина у пещерных рыб одинаковы утром и вечером в темноте и темноте (рис. 6). Уменьшение ночного сна, которое мы наблюдали у aanat2 crispants, демонстрирует, что, когда aanat2 не транскрибируется, продолжительность ночного сна значительно сокращается в A . Мексика . Этот результат демонстрирует, что эволюционирующие изменения циркадных ритмов в экспрессии генов, которые выводятся из основных часов, могут повлиять на эволюцию сна.Наши данные показали пониженную ритмическую экспрессию rorca во всех популяциях пещер, а криспантс указал, что rorca играет роль в регулировании продолжительности сна в целом. Следовательно, мы предполагаем, что нарушение регуляции основных часов и нижестоящих циркадных регуляторов цикла сна-бодрствования способствует повторяющейся эволюции сокращения продолжительности сна у пещерных рыб.

    Потеря света из окружающей среды имеет последствия для приспособленности организма, выходящие за рамки циркадной физиологии.Свет окружающей среды играет важную роль в контроле клеточного цикла и активации репарации ДНК у костистых насекомых. Предыдущая работа в этой системе показала, что пещерное население A . mexicanus демонстрируют более высокие уровни активности репарации ДНК и повышенную экспрессию генов репарации ДНК в темноте [24]. Поскольку общий световой сигнальный путь контролирует как репарацию ДНК, так и вовлечение часов, один из предложенных механизмов заключается в том, что пещерные рыбы поддерживают повышенную регуляцию часовых генов, обычно управляемых светом, сродни «восприятию» длительного воздействия света [24].Мы обнаружили, что гены репарации ДНК чаще активируются у целых мальков из пещерных популяций (таблица J в тексте S1), а гены, участвующие в репарации ДНК, демонстрируют усиленную или уникально ритмичную экспрессию у Molino и Tinaja (см. Текст S1). Однако гены, связанные со световой индукцией, не имели большей вероятности активироваться у пещерных рыб по сравнению с поверхностными рыбами в темно-темных условиях (Таблица K в тексте S1). Активируемые светом гены в основной циркадной петле обратной связи также не были постоянно активированы в популяциях пещер (см. Текст S1).Таким образом, хотя наши анализы подтверждают изменения в системе репарации ДНК у пещерных рыб, особенно у Молино и Тинаха, необходима дополнительная работа, чтобы понять взаимосвязь между путём ввода света, эволюцией часов и регуляцией репарации ДНК в этой системе.

    На фоне независимых нарушений регуляции циркадного транскриптома мы идентифицировали общий набор генов со значительной ритмической экспрессией во всех пещерных и поверхностных популяциях. К ним относятся гены первичного (например,g., per1a , per1b ) и вспомогательные петли (например, dbpb , cipca ). Эти гены могут представлять собой подмножество компонентов часов, которые минимально необходимы для поддержания некоторой эндогенной ритмической физиологии, или могут находиться под сильным ограничением своей роли в других функциях организма. В качестве альтернативы, общие устойчивые ритмы этих генов могут быть общей стохастической особенностью нерегулируемых циркадных часов. Per1b , например, несмотря на его устойчивую ритмическую активность, демонстрирует доказательства ослабленного отбора и содержит предсказанные вредные замены.

    В целом, это исследование дало новые и важные открытия на стыке эволюционной биологии и хронобиологии. Мы продемонстрировали, что перед лицом потери ключевых экологических цейтгеберов в трех пещерных популяциях произошли широко распространенные нарушения циркадного транскриптома. Наш анализ поддерживает модель, в которой нарушения биологических часов развивались независимо и с помощью различных молекулярных механизмов в разных популяциях. Следовательно, наши результаты демонстрируют, что перемещение в преимущественно аритмичную среду, такую ​​как пещеры, может привести к предсказуемому ослаблению или потере эндогенных транскрипционных ритмов даже в относительно коротких эволюционных временных масштабах, и такая потеря циркадной функции может влиять на фенотипы сна.

    Методы

    Заявление об этике

    Эксперименты

    были одобрены институциональным комитетом по уходу и использованию животных Атлантического университета Флориды (протоколы № A15-32 и № A18-38) и институциональным комитетом по уходу и использованию животных (IACUC) Института медицинских исследований Стоуэрса (разрешение учреждения 2019 г. –084).

    Выборка

    Чтобы понять, в какой степени пещерные популяции поддерживают функциональные биологические часы и сравнивают транскриптомы пещерных и поверхностных рыб, образцы каждой популяции были взяты из одной и той же лабораторной брачной кладки и выращены в цикле свет-темнота 14:10.Светло-темные условия имитируют наследственное состояние пещерных рыб, и выращивание всех рыб в этих условиях позволяет нам сделать вывод о появившихся различиях в циркадном транскриптоме между пещерными и поверхностными популяциями [70]. Экспериментальные особи произошли от беспородных лабораторных особей. Чтобы избежать захвата пищи, в резервуары добавляли достаточно еды, чтобы еда была всегда под рукой. Дополнительную пищу добавляли каждый день в течение 2-3 часов. Все рыбы находились ровно через 30 дней после оплодотворения в начале эксперимента.Рыбы содержались в полной темноте в течение 24 часов до отбора проб и на протяжении всего эксперимента. Во время эксперимента пищу добавляли дважды в день, утром и вечером (ровно в 8:00 и 20:00), однако еда была доступна в любое время, потому что большая часть не была съедена сразу. Сначала отбирали пробы из шести повторностей в 6 часов утра (циркадное время 0), а затем каждые четыре часа до 2 часов ночи (что соответствует CT 20). Индивидуумов немедленно замораживали в жидком азоте. РНК экстрагировали из всего организма с помощью партии экстракции, рандомизированной по времени отбора проб и популяции.Образцы секвенировали на платформе Illumina HiSeq 2500 для получения считываний парных концов 125 пар оснований (данные S1) с использованием препаратов библиотеки, специфичной для цепи. Образцы были рандомизированы по дорожкам секвенирования относительно популяции и времени отбора. Предыдущая работа не показала влияния партии экстракции или дорожки на эти образцы [88].

    Считать отображение

    Рида очищены от загрязнений адаптеров и некачественных баз с помощью Trimmomatic (v0.33) [89]. Очищенные чтения были сопоставлены с A . mexicanus черновик сборки генома v1.02 (GCA_000372685.1) со STAR [90] и считывания перекрывающихся экзонных областей подсчитывали с помощью Stringtie (v1.3.3d) [91] на основе A . mexicanus Ensembl v91 annotation. Гены с менее чем 100 чтениями во всех образцах были исключены из анализа. Чтения впоследствии были нормализованы по размеру библиотеки и преобразованы с помощью преобразования, стабилизирующего дисперсию, с помощью DESeq2 [92] для анализа основных компонентов.

    Идентификация ритмических транскриптов

    Ритмических транскриптов с 24-часовой периодичностью идентифицировали с помощью программы JTK_cycle [51], используя один 24-часовой цикл с интервалом 4 часа и 6 повторами на момент времени.JTK_cycle также использовался для оценки амплитуды и фазы каждого ритмического транскрипта. Мы сохранили гены как ритмичные с коэффициентом ложного обнаружения (FDR) 5%. Наш общий результат, заключающийся в том, что в популяции на поверхности циркулирует больше генов, чем в популяциях пещер (Таблица A в тексте S1), был нечувствителен к конкретному значению отсечки FDR. Мы определили аритмические транскрипты на уровне p -значение> 0,5, консервативное пороговое значение для аритмической экспрессии, которое использовалось в других исследованиях [66,93].

    Важное предостережение в нашем анализе ритмической экспрессии состоит в том, что пещерные и поверхностные формы различаются по своей пропорции ткани сетчатки на 30 dpf.Однако из-за децентрализованной природы костистых биологических часов, когда ткани имеют независимые, чувствительные к свету кардиостимуляторы, это преимущественно влияет на транскрипты, которые являются ритмичными только или преимущественно в сетчатке. Поскольку большинство циркадных генов проходят цикл в нескольких тканях рыб (включая первичные и дополнительные петли обратной связи), наше сравнение сможет учесть возникшие различия в ритмичности этих транскриптов. В соответствии с этим представлением, большая часть дисрегуляции, которую мы обнаружили в циркадной транскрипции пещерных популяций, зависит от популяции.Не ожидается, что популяционная потеря ритмической экспрессии будет преобладающей, если нарушение регуляции происходит только из-за потери ткани сетчатки.

    Анализ дифференциальной ритмичности

    Чтобы идентифицировать дифференциальную ритмичность между парами популяций, мы рассчитали оценку дифференциальной ритмичности (S DR ) для генов со значением JTK_cycle p <1 в любой популяции. Как и в Kuintzle et al . [66], S DR был определен как: Где Z p — это Z-оценка для изменений периодичности между популяциями, где изменения периодичности определяются как log ( p -значение популяции 1) –log ( p -значение популяции 2).Z R — это Z-оценка, рассчитанная для изменений амплитуды между популяциями, где изменения амплитуды определяются как: log 2 (Амплитуда популяции 2 / Амплитуда популяции 1). Амплитуда каждого гена оценивалась с помощью JTK_cycle.

    Затем мы вычислили значение p для значений S DR , используя распределение Гаусса на основе соответствия эмпирическому распределению. Мы использовали R p . отрегулируйте для выполнения поправки Бенджамини и Хохберга для множественных испытаний (таблица I в тексте S1).

    Промоторный анализ ритмических генов

    Мы определили предполагаемые промоторы как область на 1 т.п.н. выше по течению и на 200 п.н. ниже сайта начала транскрипции (TSS) [52]. Генетические данные популяций [50] были использованы для идентификации вариантов с предполагаемыми промоторными областями, разделяющими популяции, и создания альтернативных эталонных геномов для каждой популяции. Гены с JTK_cycle FDR <0,1 на поверхности были использованы для идентификации фазового обогащения циркадных элементов цис- в популяции на поверхности.FIMO из набора MEME [94] использовали для идентификации мотивов в каждом промоторе. FIMO использовали для оценки значений p для мотивов в каждой последовательности; мотивы со значениями p <0,0001 (отсечение по умолчанию) рассматривались для последующих анализов. Примечательно, что более дистальные регуляторные элементы cis- будут исключены из этого сканирования. Чтобы идентифицировать фазово-специфическое обогащение связывающих мотивов, мы проверили скользящие временные окна с точными тестами Фишера для мотивов в фазе по сравнению с мотивами вне фазы по сравнению с общим набором генов в фазе и вне фазы.Чтобы вычислить изменения в фазе генов, которые являются предполагаемыми мишенями для факторов циркадной транскрипции между поверхностным и пещерным населением, мы рассчитали минимальное расстояние между пиком экспрессии между пещерным и поверхностным населением на основе 24-часовых часов. Более подробная информация об этом анализе доступна в S1 Text.

    Тканевый препарат для флуоресценции РНК гибридизации in situ (FISH)

    Pachón, Molino, Tinaja и поверхностные рыбы, полученные из популяции Río Choy, были выращены с плотностью 20–25 особей на 3 л резервуара в цикле 14: 10LD при 23 ° C и проводимости 750–800 мкСм / см, с кормлением и качеством воды. контроль, как описано ранее [95].

    Чтобы сделать РНК FISH сопоставимой с нашим анализом RNAseq, визуализацию проводили на мальках 30dpf. 29 рыбок dpf помещали в постоянную темноту в темную фазу дня, предшествующего забору тканей. Рыбу 30dpf кормили ad libitum с добавлением дополнительного корма в 8:00 и 20:00 в день сбора тканей. Отдельную рыбу умерщвляли в MS-222 в CT0, CT8 и CT16. Эксперименты проводили в двух экземплярах: по две рыбы умерщвляли и вскрывали в каждый момент времени из каждой популяции.Перед фиксацией были приложены все усилия, чтобы уменьшить воздействие света. Вскрытый мозг и печень помещали в свежеприготовленный раствор 4% PFA в DEPC 1X ​​PBS на льду. Через 3-5 минут на льду образцы были переведены в комнатную температуру и оставлены для фиксации в течение 1 часа. Затем образцы помещали при 4 ° C на 36 часов. Через 36 часов образцы кратковременно промывали водой DEPC и трижды промывали DEPC 1X ​​PBS в течение 15 минут при постоянном встряхивании. Промывка с помощью градиента EtOH (30% — 50% — 70% — 100%) была проведена в воде, обработанной DEPC, с 5-минутным перерывом между этапами.

    Обработку тканей и заливку парафином выполняли с помощью гибридного тканевого процессора PATHOS Delta (Milestone Medical Technologies, Inc, MI, США) [96]. Парафиновые срезы нарезали толщиной 12 мкм с использованием микротома Leica RM2255 (Leica Biosystems Inc. Buffalo Grove, IL, USA) в условиях отсутствия РНКазы. Мозг был разрезан коронально через средний и промежуточный мозг, чтобы позволить визуализировать оптическую пластину и перивентрикулярную серую зону, участки, показывающие значительную экспрессию генов часов у рыбок данио [97] и последовательно идентифицируемые, несмотря на небольшой размер среднего мозга 30 dpf (рис. O в тексте S1). .Нам не удалось последовательно провести разрез одной и той же области мозга, чтобы сравнить экспрессию в ядрах гипоталамуса из-за размера мозга 30dpf [97]. Продольный разрез печени. Срезы помещали на заряженные предметные стекла SureBond (каталожный № SL6332-1, Avantik, Спрингфилд, Нью-Джерси, США). Чтобы обеспечить возможность сравнения между популяциями, все мозги или печень из одного набора зондов обрабатывались одновременно (например, rorca-rorcb мозгов из всех популяций, и все временные точки обрабатывались одновременно).Кроме того, мозг или печень из каждой временной точки (CT0, CT8, CT16) обрабатывались на одном слайде, чтобы обеспечить прямое сравнение между временными точками в популяциях.

    РНК FISH, визуализация и анализ

    Зонды

    для РНКскоп были разработаны ACDBio для нацеливания на все известные транскрипты мРНК генов per1a (ENSAMXG00000019909), arntl1a (ENSAMXG00000011758), rorca (ENSAMXG00000009363cb) и 0000 rororca (ENSAMXG00000009363cb) Калифорния, США) на основе Astyanax_mexicanus-2.0, сборка INSDC (GCA_000372685). Были заказаны зонды для двойного сплетения ( per1a-arntl1a и rorca-rorcb ) для обеспечения внутреннего контроля в каждом образце для фазы и количества мРНК. Зонды можно заказать в интернет-магазине ACD по следующим каталожным номерам: per1a (5

    ),

    arntl1a (5

    -C2),

    rorca (5 ) и rorcb (5
    -C2). In situ гибридизацию мРНК per1a , arntl1a , rorca и rorcb проводили на парафиновых срезах с использованием набора RNAscope Multiplex Fluorescent Detection Kit v2 (Advanced Cell Diagnostics, Hayward, CA, USA) в соответствии с инструкциями производителя. протокол.

    Предметные стекла перед визуализацией хранили в темноте при 4 ° C. Флуоресцентные изображения срезов были получены с помощью Nikon Eclipse TI, оснащенного вращающейся дисковой головкой Yokogawa CSU W1 и камерой Hamamatsu ORCA-Flash 4.O для получения изображений с высоким разрешением с использованием объектива Nikon 20x / 0,75 Plan Apo. Зонды rorca и per1a были получены с помощью лазера 561 нм и собраны с помощью эмиссионного фильтра ET605 / 70m, а зонды arntl1a и rorcb — с помощью лазера 633 нм и собраны с помощью эмиссионного фильтра ET700 / 75m.DAPI возбуждали при 405 нм и собирали эмиссионным фильтром ET455 / 50m. Образцы были автоматически идентифицированы для визуализации с использованием специального сценария, как в Guo и др. . [98], и каждый образец отображался как сканирование плитки с 10% перекрытием и z-стеком глубиной 18 мкм с толщиной оптического среза 0,9 мкм. Настройки микроскопа и камеры во время сбора данных были идентичны для всех образцов, чтобы обеспечить прямое сравнение между временными точками и популяциями. Обработка изображений на Фиджи [99] была идентична для популяций и временных точек в наборе ткани и зонда.Вкратце, плитки были сшиты в единое изображение с использованием сшивки сетки / коллекции [100], максимальное проецирование и регулировка контраста. Чтобы правильно сравнить популяции пещер с популяциями на поверхности, мы устанавливаем диапазоны интенсивности для каждого изображения, соответствующие образцам изображений поверхности (рис. 4). Интенсивность изображений мозга Molino и Tinaja на рис. K в тексте S1 скорректирована с учетом перенасыщения. На рис. 4 исключен канал DAPI. Соответствующее окрашивание DAPI можно найти на рис. J в тексте S1. Изображения представляют две рыбы, собранные в каждый момент времени для каждой популяции.На Рис. 4 показаны максимальные проецируемые изображения.

    Для количественной оценки на рис. 5 плитки были сшиты в полное изображение с использованием сшивания сетки / коллекции [100]. Сшитые изображения были спроектированы в сумме, а фон вычтен. При визуальном осмотре было идентифицировано 400×400 представляющих интерес анатомических областей, и была измерена средняя интенсивность для каждого канала. Чтобы обеспечить возможность сравнения относительной экспрессии на клетку из нескольких образцов, интенсивность DAPI была измерена в качестве прокси для плотности клеток, а интенсивность сигнала FISH была нормализована по интенсивности DAPI для каждой области.Технические реплики (два-три среза одной и той же печени или мозга) усредняли для получения биологических реплик, представленных точками на рис. 5. Все группы имеют две биологические реплики, за исключением rorca rorcb Pachón мозга, у которых есть только один из-за потери образца. Построение графиков и статистический анализ выполняли с использованием программного обеспечения GraphPad Prism (GraphPad, Prism версии 8.3.0, GraphPad Software, Сан-Диего, Калифорния, США). Для каждого мРНК-зонда средние значения популяции пещер сравнивали со средним контрольным значением (поверхность) в определенные моменты времени с использованием 2-стороннего дисперсионного анализа.Тест Даннета использовался для исправления множественных сравнений между популяциями и временными точками. Исходные изображения, лежащие в основе этой части рукописи, доступны в репозитории исходных данных Stowers по адресу ftp://odr.stowers.org/LIBPB-1485.

    Геномный анализ населения

    Генетический анализ популяций был проведен с использованием образцов из Herman et al . [50] с использованием особей из Рио Чой (N = 9), Пачона (N = 9 + эталонный геном), Tinaja (N = 10), Molino ( N = 9), а также еще одна популяция на поверхности, Rascón (N = 8).Чтобы идентифицировать регионы, которые были дифференцированы между пещерным и поверхностным населением, мы рассчитали несколько показателей на основе запросов о вариантах популяции (см. S1 Text). VCFtools v0.1.13 [101] и пользовательские скрипты использовались для расчета основных генетических показателей популяции (π, F ST и d XY ) в кодирующей области для каждого гена. Для сравнений F ST и d XY мы сравнили каждую популяцию пещер с двумя поверхностными популяциями, Рио Чой и Раскон.

    Для прогнозирования эффектов замен в циркадных генах в пещерных популяциях мы использовали два инструмента прогнозирования in silico : Ensembl Variant Effect Predictor (VEP, Ensembl release 100) [102] и Sorting Intolerant from Tolerant (SIFT 4G Annotator, v2 .4) [103]. Варианты с высокой частотой встречаемости (когда вариант встречается с частотой> 0,8 по крайней мере в одной пещерной популяции, но не присутствует в популяции на поверхности Рио-Чой) были классифицированы как потенциально опасные, если VEP пометил их как «сильно воздействующие» или «вредные». ”Пользователя SIFT.

    Тестирование для расслабленного отбора на часовых генах

    Ансамблевые аннотации

    (v102) использовались для однозначной идентификации ортологов в линиях костистости и A . Мексика . Кодирующие последовательности и аннотации были загружены с Ensembl с помощью BioMart. Последовательности были согласованы с реализацией алгоритма MAFFT в GUIDANCE2 [104] в кодонном режиме [105]. Последовательности пещерных рыб были протестированы на ослабление ограничений в рамках RELAX [79]. RELAX подбирает нулевую модель из 3 классов ω по филогенезу, а затем сравнивает соответствие этой модели с альтернативной моделью, где ветви подразделяются на тестовые и эталонные наборы, с тестом отношения правдоподобия (LRT). k , определяемый как параметр интенсивности выбора, представляет собой показатель степени значений ω для тестовых ветвей в альтернативной модели. k > 1 указывает, что сила отбора усилилась, а k <1 указывает, что сила отбора ослаблена. Дерево Newick с филогенией костистых растений было предоставлено на основе Ensembl Species Tree, созданного в рамках конвейера Ensembl Compara. Мы протестировали расслабленный отбор отдельно в ветвях, ведущих к Тинаха / Пачон и Молино, на основании взаимосвязи между пещерным и поверхностным населением, описанной в [50].Более подробная информация об этом анализе доступна в S1 Text.

    Количественное определение мелатонина

    Как и в нашем эксперименте RNAseq, рыбу выращивали в периоде 14:10 свет-темнота. Через 30 дней после оплодотворения уровни мелатонина анализировали в (1) условиях света-темноты и (2) в условиях темноты-темноты для каждой популяции. Для эксперимента «темно-темно» рыбу держали в полной темноте в течение 24 часов до отбора проб и на протяжении всего эксперимента. Десять личинок рыб были объединены вместе, гомогенизированы и мелатонин экстрагирован из каждого образца, как описано ранее [106], со следующими модификациями: метиленхлорид выпаривали под паром азота при 40 ° C.Высушенные экстракты элюировали 0,7 мл PBS с 0,1% желатином Knox. Затем каждый образец анализировали с помощью ELISA на мелатонин в слюне (Alpco), следуя инструкциям производителя.

    Дизайн и генотипирование CRISPR / Cas9

    Функциональные эксперименты были выполнены на личиночных рыбах с инъекцией CRISPR / Cas9 (хрустящие) для aanat2 и rorca . ГРНК CRISPR были сконструированы с использованием программы ChopChop v3 [107]. мРНК были сконструированы для нацеливания на экзон в каждом из генов и для создания двухцепочечного разрыва рядом с сайтом рестрикционного фермента для целей генотипирования.Для aanat2 gRNA была 5′-GGTGTGCCGCCGCTGCCGGA-3 ‘, а для rorca gRNA была 5′-gGAGAACGGTAACGGCGGGCA-3′, где g в нижнем регистре на 5′-конце был добавлен к последовательности для транскрипции T7 (рестрикционный фермент целевые сайты подчеркнуты). гРНК синтезировали, как описано ранее [108], с модификациями [109,110]. Вкратце, были синтезированы специфичные для гРНК олигонуклеотиды (IDT), которые содержали целевой сайт гРНК, промотор Т7 и перекрывающуюся последовательность:

    aanat2 олиго A:

    5’- TAATACGACTCACTATAGGTGTGCCGCCGCTGCCGGAGTTTTAGAGCTAGAAATAGC-3 ’

    rorca олиго A:

    5’-TAATACGACTCACTATAgGAGAACGGTAACGGCGGGCAGTTTTAGAGCTAGAAATAGC-3 ’

    Каждый олиго A был отожжен до олиго B:

    5’-GATCCGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3 ’

    , и эти отожженные олигонуклеотиды были амплифицированы.гРНК транскрибировали с использованием набора T7 Megascript (Ambion), как в Klaassen и др. . [111] и Stahl и др. . [110], и очищали с использованием мини-набора miRNeasy (Qiagen). МРНК Nls-Cas9-nls [112] транскрибировали с помощью набора mMessage mMachine T3 (Life Technologies) в соответствии с инструкциями производителя и очищали с помощью набора RNeasy MinElute (Qiagen) в соответствии с инструкциями производителя. 150 мкг мРНК Cas9 и 25 мкг мРНК aanat2 или 150 мкг мРНК Cas9 и 25 мкг мкРНК rorca инъецировали в эмбрионы рыб с одноклеточной поверхностью (вводили 2 нл / эмбрион).

    Геномная ДНК из инъецированных эмбрионов и контрольных образцов дикого типа (без инъекций) была извлечена через 48 часов после оплодотворения [109, 110] и использована для генотипирования с помощью ПЦР, чтобы определить, был ли достигнут мутагенез в локусе с помощью гель-электрофореза (рис. R и S в S1. Текст). Вкратце, гРНК были сконструированы так, чтобы разрушать сайты специфических рестрикционных ферментов; образцы инкубировали с этим ферментом рестрикции, чтобы определить, содержат ли они индуцированные CRISPR / Cas9 мутации, нарушающие сайт фермента рестрикции.Непереваренный фрагмент действует как контроль, в то время как переваренный фрагмент используется для генотипа. Если фрагмент не переварен, это указывает на то, что рестрикционный фермент не смог разрезать из-за нарушения сайта из-за мутаций, индуцированных CRISPR / Cas9. Специфичные для генов праймеры представлены в S1 Data. ПЦР проводили при температуре отжига 56 ° C и времени продления 1 минута для 35 циклов. Полученный продукт ПЦР делили пополам, и половину расщепляли рестрикционным ферментом. Фрагмент ДНК, содержащий целевой фрагмент aanat2 , расщепляли с помощью Bb vI (New England Biolabs Inc.). Фрагмент ДНК rorca расщепляли с помощью Cac 8I (New England Biolabs). Оба фрагмента ДНК переваривали при 37 ° C в течение 1 часа.

    Для людей дикого типа для клонирования использовали фрагмент ПЦР. Для хрустящей рыбы проводили расщепление рестрикционными ферментами (как описано выше), и непереваренные полосы очищали в геле с использованием набора для экстракции геля (Qiagen). Продукты ПЦР клонировали в вектор pGEM-T Easy (Promega), и три клона на индивидуума были отобраны, выращены и очищены с использованием набора QIAprep Spin Miniprep (Qiagen), а затем секвенированы секвенированием по Сэнгеру для генотипирования (Eurofins Genomics).

    Количественная оценка поведения сна

    Хрустящие рыбы с инъекцией 30 dpf и контрольные братья и сестры WT (без инъекций) использовали для всех поведенческих экспериментов. Рыбы содержались в цикле 10–14 свет-темнота на протяжении всего развития, а также для поведенческих экспериментов. Рыбы помещали в 12-луночные планшеты для культивирования тканей (Cellstar) за 18–24 часа до записи поведения для акклиматизации к камере для записи. Перед началом регистрации, которая начиналась в ZT0 (время Цайтгебера) и длилась 24 часа, рыбу кормили обычным кормом из рассольных креветок.Видеозаписи обрабатывались в Ethovision XT (v13). Необработанные локомоторные данные обрабатывались с помощью специально написанных сценариев для количественной оценки продолжительности сна и поведенческой архитектуры, таких как локомоторное расстояние, активность бодрствования, продолжительность периода сна и количество циклов сна [44,83].

    Добавить комментарий

    Ваш адрес email не будет опубликован.